Incidental Mutation 'R1808:Cbl'
ID203611
Institutional Source Beutler Lab
Gene Symbol Cbl
Ensembl Gene ENSMUSG00000034342
Gene NameCasitas B-lineage lymphoma
SynonymsCbl-2, c-Cbl
MMRRC Submission 039837-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R1808 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44142976-44234049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44164229 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 373 (G373V)
Ref Sequence ENSEMBL: ENSMUSP00000146244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037644] [ENSMUST00000205968] [ENSMUST00000206147] [ENSMUST00000206720]
Predicted Effect probably damaging
Transcript: ENSMUST00000037644
AA Change: G373V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041902
Gene: ENSMUSG00000034342
AA Change: G373V

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Pfam:Cbl_N 49 173 9.4e-59 PFAM
Pfam:Cbl_N2 177 260 4.7e-44 PFAM
Pfam:Cbl_N3 262 347 7.2e-48 PFAM
RING 379 417 1.04e-7 SMART
low complexity region 454 463 N/A INTRINSIC
low complexity region 530 549 N/A INTRINSIC
UBA 864 901 3.17e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205968
Predicted Effect probably damaging
Transcript: ENSMUST00000206147
AA Change: G373V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206629
Predicted Effect probably damaging
Transcript: ENSMUST00000206720
AA Change: G373V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased thymic CD3 and CD4 expression and tyrosine-phosphorylation, lymphoid hyperplasia, and altered splenic hemopoiesis. Females show increased ductal density and branching in mammary fat pads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik G T 5: 146,184,881 Y69* probably null Het
2310011J03Rik A G 10: 80,320,181 probably null Het
A2ml1 A C 6: 128,543,299 D1367E probably damaging Het
Adam6a C G 12: 113,544,714 L236V probably benign Het
Arf3 T C 15: 98,741,073 N101S probably benign Het
Arhgap42 T C 9: 9,180,050 E76G probably damaging Het
Atp2a1 A G 7: 126,453,401 F382S probably damaging Het
Bud13 T A 9: 46,288,407 F355L probably benign Het
C2 G A 17: 34,864,532 P349S probably damaging Het
Ccdc3 T A 2: 5,138,085 L51Q probably damaging Het
Ccdc34 T A 2: 110,044,256 M320K probably benign Het
Cntln A G 4: 85,096,763 E1097G probably damaging Het
Ctsc A C 7: 88,299,542 K195Q possibly damaging Het
Ctsf C T 19: 4,856,534 P163L probably benign Het
Dcxr A T 11: 120,725,612 probably null Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dnah8 T C 17: 30,684,186 L933P probably damaging Het
Dtna T C 18: 23,569,640 L76P probably damaging Het
Fcgbp T A 7: 28,085,090 C192S probably benign Het
Galnt5 T A 2: 58,026,125 D683E probably benign Het
Greb1l G A 18: 10,542,143 A1297T probably benign Het
Grik4 T C 9: 42,629,026 N286S probably benign Het
Hrc A T 7: 45,336,778 E451V probably damaging Het
Hrh3 G A 2: 180,099,784 probably benign Het
Ints13 A G 6: 146,554,197 I152T probably damaging Het
Irgm1 A T 11: 48,866,432 V184D probably damaging Het
Itga5 C T 15: 103,350,399 A791T probably damaging Het
Kcp T C 6: 29,505,655 T73A probably benign Het
Kidins220 A G 12: 25,003,009 T433A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2d T C 15: 98,866,686 D12G probably damaging Het
Mms19 A G 19: 41,966,259 S74P probably damaging Het
Myh1 G T 11: 67,211,474 E864* probably null Het
Nek1 A G 8: 61,016,230 D107G probably damaging Het
Npc1 T C 18: 12,194,092 N1149D probably damaging Het
Olfr127 T A 17: 37,903,770 S75T probably damaging Het
Olfr1280 T C 2: 111,315,998 V173A probably benign Het
Olfr401 C A 11: 74,121,431 S47R probably damaging Het
Olfr507 A C 7: 108,622,610 K266T possibly damaging Het
Osbp T C 19: 11,970,778 S150P probably damaging Het
Paf1 T C 7: 28,396,822 Y287H probably damaging Het
Pdgfrb T C 18: 61,068,102 V420A probably benign Het
Pdss1 G T 2: 22,906,834 E120* probably null Het
Pink1 A T 4: 138,317,319 V339E probably damaging Het
Pkn3 C T 2: 30,079,651 R58C probably damaging Het
Pm20d1 G A 1: 131,802,427 V235I probably benign Het
Ppp2r2a A G 14: 67,038,963 I31T probably damaging Het
Rbms3 T C 9: 116,822,826 E152G probably damaging Het
Rfx1 A C 8: 84,095,048 Q804H probably damaging Het
Rpe G T 1: 66,715,197 V143L probably benign Het
Sap30l G T 11: 57,809,945 V142L probably benign Het
Sh3tc1 T C 5: 35,705,924 Q973R probably benign Het
Slc10a2 T C 8: 5,104,856 T110A probably damaging Het
Snrnp200 A T 2: 127,219,027 probably null Het
Snrnp200 G A 2: 127,219,028 probably null Het
Spaca3 T A 11: 80,867,685 V158E probably damaging Het
Sprtn C A 8: 124,903,031 N354K probably benign Het
Stab1 T A 14: 31,141,144 Y2166F possibly damaging Het
Tmem106c G A 15: 97,968,667 probably null Het
Tnc A G 4: 63,999,931 S1248P probably damaging Het
Tshr T C 12: 91,537,316 F343L probably benign Het
Ttn C A 2: 76,725,354 A30436S probably damaging Het
Ubxn2a A T 12: 4,885,839 M68K probably benign Het
Ucp2 T C 7: 100,498,814 V238A probably damaging Het
Urgcp C A 11: 5,717,242 L365F probably damaging Het
Vezt A T 10: 93,990,164 D328E probably damaging Het
Vmn1r168 G T 7: 23,540,759 V14L probably benign Het
Vps13b T C 15: 35,792,059 F2158L probably benign Het
Other mutations in Cbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Cbl APN 9 44201198 missense probably damaging 1.00
IGL01369:Cbl APN 9 44201061 nonsense probably null
IGL01434:Cbl APN 9 44164206 missense probably damaging 0.99
IGL01866:Cbl APN 9 44153825 nonsense probably null
IGL02326:Cbl APN 9 44151473 missense possibly damaging 0.94
IGL02956:Cbl APN 9 44169034 missense probably damaging 1.00
R0068:Cbl UTSW 9 44154194 missense probably damaging 0.98
R0390:Cbl UTSW 9 44201005 missense probably damaging 1.00
R0655:Cbl UTSW 9 44158752 missense probably damaging 1.00
R0764:Cbl UTSW 9 44164152 missense probably damaging 1.00
R1466:Cbl UTSW 9 44154244 missense probably benign 0.10
R1466:Cbl UTSW 9 44154244 missense probably benign 0.10
R1616:Cbl UTSW 9 44152900 missense probably damaging 0.99
R1736:Cbl UTSW 9 44152895 missense possibly damaging 0.80
R1865:Cbl UTSW 9 44164165 missense probably damaging 1.00
R3156:Cbl UTSW 9 44158850 missense possibly damaging 0.74
R3431:Cbl UTSW 9 44151446 makesense probably null
R4668:Cbl UTSW 9 44153848 missense probably benign 0.00
R4700:Cbl UTSW 9 44173380 missense probably damaging 1.00
R4866:Cbl UTSW 9 44152869 missense probably benign 0.00
R4900:Cbl UTSW 9 44152869 missense probably benign 0.00
R4995:Cbl UTSW 9 44153811 missense possibly damaging 0.62
R5014:Cbl UTSW 9 44154399 intron probably null
R5324:Cbl UTSW 9 44154254 missense probably damaging 0.97
R5353:Cbl UTSW 9 44173323 missense probably damaging 1.00
R5382:Cbl UTSW 9 44159021 missense probably benign
R5747:Cbl UTSW 9 44201119 missense probably damaging 1.00
R5834:Cbl UTSW 9 44233779 missense probably damaging 1.00
R6307:Cbl UTSW 9 44158512 critical splice donor site probably null
R6755:Cbl UTSW 9 44173374 missense probably damaging 0.98
R7393:Cbl UTSW 9 44154188 critical splice donor site probably null
X0057:Cbl UTSW 9 44233767 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCTAAACTTATCCCATCCTTTC -3'
(R):5'- TAAACCACTGACTAGTAAGAGAGTG -3'

Sequencing Primer
(F):5'- TTGGACATCCATACCTGC -3'
(R):5'- CCAAGTCAACATCGGGTATCTATCTG -3'
Posted On2014-06-23