Incidental Mutation 'R1808:Irgm1'
ID203617
Institutional Source Beutler Lab
Gene Symbol Irgm1
Ensembl Gene ENSMUSG00000046879
Gene Nameimmunity-related GTPase family M member 1
SynonymsIfi1, LRG-47, Irgm, Iigp3
MMRRC Submission 039837-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1808 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location48861968-48871683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48866432 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 184 (V184D)
Ref Sequence ENSEMBL: ENSMUSP00000094870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049519] [ENSMUST00000097271]
Predicted Effect probably damaging
Transcript: ENSMUST00000049519
AA Change: V200D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050446
Gene: ENSMUSG00000046879
AA Change: V200D

DomainStartEndE-ValueType
Pfam:IIGP 42 399 5.5e-169 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097271
AA Change: V184D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000094870
Gene: ENSMUSG00000046879
AA Change: V184D

DomainStartEndE-ValueType
Pfam:IIGP 26 288 2.5e-131 PFAM
Pfam:MMR_HSR1 62 175 2.8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147151
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: In the absence of infection, mice show no overt phenotype. Resistance to protozoan parasitic infection and bacterial infection is impaired in homozygous mutant mice, whereas resistance to viral infection is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik G T 5: 146,184,881 Y69* probably null Het
2310011J03Rik A G 10: 80,320,181 probably null Het
A2ml1 A C 6: 128,543,299 D1367E probably damaging Het
Adam6a C G 12: 113,544,714 L236V probably benign Het
Arf3 T C 15: 98,741,073 N101S probably benign Het
Arhgap42 T C 9: 9,180,050 E76G probably damaging Het
Atp2a1 A G 7: 126,453,401 F382S probably damaging Het
Bud13 T A 9: 46,288,407 F355L probably benign Het
C2 G A 17: 34,864,532 P349S probably damaging Het
Cbl C A 9: 44,164,229 G373V probably damaging Het
Ccdc3 T A 2: 5,138,085 L51Q probably damaging Het
Ccdc34 T A 2: 110,044,256 M320K probably benign Het
Cntln A G 4: 85,096,763 E1097G probably damaging Het
Ctsc A C 7: 88,299,542 K195Q possibly damaging Het
Ctsf C T 19: 4,856,534 P163L probably benign Het
Dcxr A T 11: 120,725,612 probably null Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dnah8 T C 17: 30,684,186 L933P probably damaging Het
Dtna T C 18: 23,569,640 L76P probably damaging Het
Fcgbp T A 7: 28,085,090 C192S probably benign Het
Galnt5 T A 2: 58,026,125 D683E probably benign Het
Greb1l G A 18: 10,542,143 A1297T probably benign Het
Grik4 T C 9: 42,629,026 N286S probably benign Het
Hrc A T 7: 45,336,778 E451V probably damaging Het
Hrh3 G A 2: 180,099,784 probably benign Het
Ints13 A G 6: 146,554,197 I152T probably damaging Het
Itga5 C T 15: 103,350,399 A791T probably damaging Het
Kcp T C 6: 29,505,655 T73A probably benign Het
Kidins220 A G 12: 25,003,009 T433A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2d T C 15: 98,866,686 D12G probably damaging Het
Mms19 A G 19: 41,966,259 S74P probably damaging Het
Myh1 G T 11: 67,211,474 E864* probably null Het
Nek1 A G 8: 61,016,230 D107G probably damaging Het
Npc1 T C 18: 12,194,092 N1149D probably damaging Het
Olfr127 T A 17: 37,903,770 S75T probably damaging Het
Olfr1280 T C 2: 111,315,998 V173A probably benign Het
Olfr401 C A 11: 74,121,431 S47R probably damaging Het
Olfr507 A C 7: 108,622,610 K266T possibly damaging Het
Osbp T C 19: 11,970,778 S150P probably damaging Het
Paf1 T C 7: 28,396,822 Y287H probably damaging Het
Pdgfrb T C 18: 61,068,102 V420A probably benign Het
Pdss1 G T 2: 22,906,834 E120* probably null Het
Pink1 A T 4: 138,317,319 V339E probably damaging Het
Pkn3 C T 2: 30,079,651 R58C probably damaging Het
Pm20d1 G A 1: 131,802,427 V235I probably benign Het
Ppp2r2a A G 14: 67,038,963 I31T probably damaging Het
Rbms3 T C 9: 116,822,826 E152G probably damaging Het
Rfx1 A C 8: 84,095,048 Q804H probably damaging Het
Rpe G T 1: 66,715,197 V143L probably benign Het
Sap30l G T 11: 57,809,945 V142L probably benign Het
Sh3tc1 T C 5: 35,705,924 Q973R probably benign Het
Slc10a2 T C 8: 5,104,856 T110A probably damaging Het
Snrnp200 A T 2: 127,219,027 probably null Het
Snrnp200 G A 2: 127,219,028 probably null Het
Spaca3 T A 11: 80,867,685 V158E probably damaging Het
Sprtn C A 8: 124,903,031 N354K probably benign Het
Stab1 T A 14: 31,141,144 Y2166F possibly damaging Het
Tmem106c G A 15: 97,968,667 probably null Het
Tnc A G 4: 63,999,931 S1248P probably damaging Het
Tshr T C 12: 91,537,316 F343L probably benign Het
Ttn C A 2: 76,725,354 A30436S probably damaging Het
Ubxn2a A T 12: 4,885,839 M68K probably benign Het
Ucp2 T C 7: 100,498,814 V238A probably damaging Het
Urgcp C A 11: 5,717,242 L365F probably damaging Het
Vezt A T 10: 93,990,164 D328E probably damaging Het
Vmn1r168 G T 7: 23,540,759 V14L probably benign Het
Vps13b T C 15: 35,792,059 F2158L probably benign Het
Other mutations in Irgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Irgm1 APN 11 48866005 nonsense probably null
IGL01821:Irgm1 APN 11 48866526 missense probably damaging 1.00
IGL02043:Irgm1 APN 11 48866815 missense probably damaging 0.98
IGL02252:Irgm1 APN 11 48866154 missense possibly damaging 0.92
IGL03153:Irgm1 APN 11 48866267 missense probably damaging 1.00
igraine UTSW 11 48866613 missense probably benign 0.33
R0487:Irgm1 UTSW 11 48866327 missense probably damaging 0.98
R1809:Irgm1 UTSW 11 48866613 missense probably benign 0.33
R1878:Irgm1 UTSW 11 48866070 missense probably benign 0.07
R2971:Irgm1 UTSW 11 48866590 nonsense probably null
R4492:Irgm1 UTSW 11 48866128 synonymous silent
R4962:Irgm1 UTSW 11 48866332 missense possibly damaging 0.93
R5186:Irgm1 UTSW 11 48866217 missense probably benign 0.00
R5794:Irgm1 UTSW 11 48866237 missense probably damaging 0.99
R6224:Irgm1 UTSW 11 48866886 missense probably benign 0.02
R6487:Irgm1 UTSW 11 48865950 missense probably benign 0.21
R6752:Irgm1 UTSW 11 48866463 missense probably damaging 1.00
R6766:Irgm1 UTSW 11 48866101 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACAGCACCTGATGTTGGAG -3'
(R):5'- CACTTTCCCAATGTGGTGCTG -3'

Sequencing Primer
(F):5'- CAGCACCTGATGTTGGAGAGATC -3'
(R):5'- ACTTACCTGGATTGGGGGCC -3'
Posted On2014-06-23