Incidental Mutation 'R1808:C2'
ID203638
Institutional Source Beutler Lab
Gene Symbol C2
Ensembl Gene ENSMUSG00000024371
Gene Namecomplement component 2 (within H-2S)
Synonymsclassical-complement pathway C3/C5 convertase
MMRRC Submission 039837-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R1808 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34862604-34898265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34864532 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 349 (P349S)
Ref Sequence ENSEMBL: ENSMUSP00000123536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025229] [ENSMUST00000025230] [ENSMUST00000128767] [ENSMUST00000146299] [ENSMUST00000148431] [ENSMUST00000152417] [ENSMUST00000154526] [ENSMUST00000176203]
Predicted Effect probably benign
Transcript: ENSMUST00000025229
SMART Domains Protein: ENSMUSP00000025229
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 751 2.53e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000025230
AA Change: P486S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025230
Gene: ENSMUSG00000024371
AA Change: P486S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CCP 22 71 8e-24 BLAST
low complexity region 72 83 N/A INTRINSIC
CCP 94 149 1.34e-11 SMART
CCP 156 210 1.89e-11 SMART
Blast:VWA 219 245 1e-7 BLAST
VWA 259 464 1.32e-31 SMART
Tryp_SPc 468 747 4.43e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127795
Predicted Effect probably benign
Transcript: ENSMUST00000128767
SMART Domains Protein: ENSMUSP00000119977
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 749 2.53e-30 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129891
AA Change: P102S
SMART Domains Protein: ENSMUSP00000120864
Gene: ENSMUSG00000092511
AA Change: P102S

DomainStartEndE-ValueType
Blast:VWA 2 77 8e-7 BLAST
Tryp_SPc 85 365 5.69e-8 SMART
CCP 310 365 4.62e-15 SMART
CCP 372 425 2.06e-12 SMART
VWA 475 680 1.07e-40 SMART
Tryp_SPc 688 959 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134300
SMART Domains Protein: ENSMUSP00000114241
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
Tryp_SPc 3 148 6.48e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000146299
AA Change: P333S
SMART Domains Protein: ENSMUSP00000117677
Gene: ENSMUSG00000092511
AA Change: P333S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
CCP 94 148 1.89e-11 SMART
VWA 103 311 1.74e-1 SMART
Tryp_SPc 315 547 1.49e-7 SMART
CCP 549 601 5.15e-1 SMART
CCP 615 670 4.62e-15 SMART
CCP 677 730 2.06e-12 SMART
VWA 780 985 1.07e-40 SMART
Tryp_SPc 993 1264 2.53e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148431
AA Change: P209S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371
AA Change: P209S

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152417
AA Change: P349S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123536
Gene: ENSMUSG00000024371
AA Change: P349S

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
CCP 19 73 1.89e-11 SMART
Blast:VWA 82 108 2e-7 BLAST
VWA 122 327 1.32e-31 SMART
Tryp_SPc 331 610 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154526
SMART Domains Protein: ENSMUSP00000120990
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 711 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176203
SMART Domains Protein: ENSMUSP00000135660
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 713 5.03e-5 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes component C2 of the classical pathway of the complement system. The encoded protein undergoes proteolytic processing mediated by component C1 resulting in C2a and C2b fragments. C2a fragment, in turn, selectively cleaves components C3 and C5 of the complement system. Mice lacking the encoded protein are found to be more susceptible to bacterial infections. Mutations in the human homolog of this gene are associated with disorders such as systemic lupus erythematosus, Henoch-Schonlein purpura, or polymyositis. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik G T 5: 146,184,881 Y69* probably null Het
2310011J03Rik A G 10: 80,320,181 probably null Het
A2ml1 A C 6: 128,543,299 D1367E probably damaging Het
Adam6a C G 12: 113,544,714 L236V probably benign Het
Arf3 T C 15: 98,741,073 N101S probably benign Het
Arhgap42 T C 9: 9,180,050 E76G probably damaging Het
Atp2a1 A G 7: 126,453,401 F382S probably damaging Het
Bud13 T A 9: 46,288,407 F355L probably benign Het
Cbl C A 9: 44,164,229 G373V probably damaging Het
Ccdc3 T A 2: 5,138,085 L51Q probably damaging Het
Ccdc34 T A 2: 110,044,256 M320K probably benign Het
Cntln A G 4: 85,096,763 E1097G probably damaging Het
Ctsc A C 7: 88,299,542 K195Q possibly damaging Het
Ctsf C T 19: 4,856,534 P163L probably benign Het
Dcxr A T 11: 120,725,612 probably null Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dnah8 T C 17: 30,684,186 L933P probably damaging Het
Dtna T C 18: 23,569,640 L76P probably damaging Het
Fcgbp T A 7: 28,085,090 C192S probably benign Het
Galnt5 T A 2: 58,026,125 D683E probably benign Het
Greb1l G A 18: 10,542,143 A1297T probably benign Het
Grik4 T C 9: 42,629,026 N286S probably benign Het
Hrc A T 7: 45,336,778 E451V probably damaging Het
Hrh3 G A 2: 180,099,784 probably benign Het
Ints13 A G 6: 146,554,197 I152T probably damaging Het
Irgm1 A T 11: 48,866,432 V184D probably damaging Het
Itga5 C T 15: 103,350,399 A791T probably damaging Het
Kcp T C 6: 29,505,655 T73A probably benign Het
Kidins220 A G 12: 25,003,009 T433A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2d T C 15: 98,866,686 D12G probably damaging Het
Mms19 A G 19: 41,966,259 S74P probably damaging Het
Myh1 G T 11: 67,211,474 E864* probably null Het
Nek1 A G 8: 61,016,230 D107G probably damaging Het
Npc1 T C 18: 12,194,092 N1149D probably damaging Het
Olfr127 T A 17: 37,903,770 S75T probably damaging Het
Olfr1280 T C 2: 111,315,998 V173A probably benign Het
Olfr401 C A 11: 74,121,431 S47R probably damaging Het
Olfr507 A C 7: 108,622,610 K266T possibly damaging Het
Osbp T C 19: 11,970,778 S150P probably damaging Het
Paf1 T C 7: 28,396,822 Y287H probably damaging Het
Pdgfrb T C 18: 61,068,102 V420A probably benign Het
Pdss1 G T 2: 22,906,834 E120* probably null Het
Pink1 A T 4: 138,317,319 V339E probably damaging Het
Pkn3 C T 2: 30,079,651 R58C probably damaging Het
Pm20d1 G A 1: 131,802,427 V235I probably benign Het
Ppp2r2a A G 14: 67,038,963 I31T probably damaging Het
Rbms3 T C 9: 116,822,826 E152G probably damaging Het
Rfx1 A C 8: 84,095,048 Q804H probably damaging Het
Rpe G T 1: 66,715,197 V143L probably benign Het
Sap30l G T 11: 57,809,945 V142L probably benign Het
Sh3tc1 T C 5: 35,705,924 Q973R probably benign Het
Slc10a2 T C 8: 5,104,856 T110A probably damaging Het
Snrnp200 A T 2: 127,219,027 probably null Het
Snrnp200 G A 2: 127,219,028 probably null Het
Spaca3 T A 11: 80,867,685 V158E probably damaging Het
Sprtn C A 8: 124,903,031 N354K probably benign Het
Stab1 T A 14: 31,141,144 Y2166F possibly damaging Het
Tmem106c G A 15: 97,968,667 probably null Het
Tnc A G 4: 63,999,931 S1248P probably damaging Het
Tshr T C 12: 91,537,316 F343L probably benign Het
Ttn C A 2: 76,725,354 A30436S probably damaging Het
Ubxn2a A T 12: 4,885,839 M68K probably benign Het
Ucp2 T C 7: 100,498,814 V238A probably damaging Het
Urgcp C A 11: 5,717,242 L365F probably damaging Het
Vezt A T 10: 93,990,164 D328E probably damaging Het
Vmn1r168 G T 7: 23,540,759 V14L probably benign Het
Vps13b T C 15: 35,792,059 F2158L probably benign Het
Other mutations in C2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:C2 APN 17 34866563 missense probably damaging 1.00
IGL02249:C2 APN 17 34864508 unclassified probably benign
IGL02568:C2 APN 17 34864349 missense possibly damaging 0.50
IGL03013:C2 APN 17 34872459 missense probably damaging 0.98
R0142:C2 UTSW 17 34873528 missense possibly damaging 0.53
R0619:C2 UTSW 17 34872503 missense probably damaging 1.00
R1401:C2 UTSW 17 34872481 missense possibly damaging 0.71
R1639:C2 UTSW 17 34872403 missense probably benign 0.02
R2133:C2 UTSW 17 34879902 missense probably damaging 1.00
R2860:C2 UTSW 17 34863878 missense possibly damaging 0.94
R2861:C2 UTSW 17 34863878 missense possibly damaging 0.94
R3882:C2 UTSW 17 34873489 missense probably benign 0.00
R4571:C2 UTSW 17 34863659 missense probably benign 0.00
R4622:C2 UTSW 17 34863674 missense probably damaging 0.99
R5611:C2 UTSW 17 34872384 missense probably damaging 0.99
R5767:C2 UTSW 17 34876456 missense possibly damaging 0.58
R6327:C2 UTSW 17 34864103 missense probably benign 0.41
R6448:C2 UTSW 17 34863359 missense possibly damaging 0.67
R6518:C2 UTSW 17 34864118 missense probably damaging 1.00
R6929:C2 UTSW 17 34864347 missense possibly damaging 0.68
R7324:C2 UTSW 17 34881688 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CATCTGAATGTCATGGAAGCAGTG -3'
(R):5'- GCACATGTTGGGTGAGTAAGC -3'

Sequencing Primer
(F):5'- ACAACAATCCGGGTTTGC -3'
(R):5'- GGTGAGTAAGCTTTGTCCCCC -3'
Posted On2014-06-23