Incidental Mutation 'R1808:Npc1'
ID203641
Institutional Source Beutler Lab
Gene Symbol Npc1
Ensembl Gene ENSMUSG00000024413
Gene NameNPC intracellular cholesterol transporter 1
Synonymsnmf164, A430089E03Rik, D18Ertd723e, C85354, D18Ertd139e, lcsd
MMRRC Submission 039837-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R1808 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location12189693-12236400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12194092 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1149 (N1149D)
Ref Sequence ENSEMBL: ENSMUSP00000025279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025276] [ENSMUST00000025279]
Predicted Effect probably benign
Transcript: ENSMUST00000025276
SMART Domains Protein: ENSMUSP00000025276
Gene: ENSMUSG00000024410

DomainStartEndE-ValueType
SCOP:d1crza1 21 169 5e-4 SMART
low complexity region 268 281 N/A INTRINSIC
Pfam:Mic1 475 632 4.4e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025279
AA Change: N1149D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413
AA Change: N1149D

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:NPC1_N 22 267 1.6e-79 PFAM
transmembrane domain 269 291 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Pfam:Patched 436 896 3.5e-52 PFAM
Pfam:MMPL 648 794 6.3e-8 PFAM
Pfam:Sterol-sensing 649 803 2.7e-56 PFAM
Pfam:Patched 1023 1252 2.9e-33 PFAM
low complexity region 1259 1273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153352
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that resides in the limiting membrane of endosomes and lysosomes and mediates intracellular cholesterol trafficking via binding of cholesterol to its N-terminal domain. It is predicted to have a cytoplasmic C-terminus, 13 transmembrane domains, and 3 large loops in the lumen of the endosome - the last loop being at the N-terminus. This protein transports low-density lipoproteins to late endosomal/lysosomal compartments where they are hydrolized and released as free cholesterol. Defects in this gene cause Niemann-Pick type C disease, a rare autosomal recessive neurodegenerative disorder characterized by over accumulation of cholesterol and glycosphingolipids in late endosomal/lysosomal compartments.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for spontaneous and chemically induced mutations may exhibit lysosomal storage of non-esterified cholesterol, neurodegeneration, ataxia, presence of foam cells, sterility, and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik G T 5: 146,184,881 Y69* probably null Het
2310011J03Rik A G 10: 80,320,181 probably null Het
A2ml1 A C 6: 128,543,299 D1367E probably damaging Het
Adam6a C G 12: 113,544,714 L236V probably benign Het
Arf3 T C 15: 98,741,073 N101S probably benign Het
Arhgap42 T C 9: 9,180,050 E76G probably damaging Het
Atp2a1 A G 7: 126,453,401 F382S probably damaging Het
Bud13 T A 9: 46,288,407 F355L probably benign Het
C2 G A 17: 34,864,532 P349S probably damaging Het
Cbl C A 9: 44,164,229 G373V probably damaging Het
Ccdc3 T A 2: 5,138,085 L51Q probably damaging Het
Ccdc34 T A 2: 110,044,256 M320K probably benign Het
Cntln A G 4: 85,096,763 E1097G probably damaging Het
Ctsc A C 7: 88,299,542 K195Q possibly damaging Het
Ctsf C T 19: 4,856,534 P163L probably benign Het
Dcxr A T 11: 120,725,612 probably null Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dnah8 T C 17: 30,684,186 L933P probably damaging Het
Dtna T C 18: 23,569,640 L76P probably damaging Het
Fcgbp T A 7: 28,085,090 C192S probably benign Het
Galnt5 T A 2: 58,026,125 D683E probably benign Het
Greb1l G A 18: 10,542,143 A1297T probably benign Het
Grik4 T C 9: 42,629,026 N286S probably benign Het
Hrc A T 7: 45,336,778 E451V probably damaging Het
Hrh3 G A 2: 180,099,784 probably benign Het
Ints13 A G 6: 146,554,197 I152T probably damaging Het
Irgm1 A T 11: 48,866,432 V184D probably damaging Het
Itga5 C T 15: 103,350,399 A791T probably damaging Het
Kcp T C 6: 29,505,655 T73A probably benign Het
Kidins220 A G 12: 25,003,009 T433A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2d T C 15: 98,866,686 D12G probably damaging Het
Mms19 A G 19: 41,966,259 S74P probably damaging Het
Myh1 G T 11: 67,211,474 E864* probably null Het
Nek1 A G 8: 61,016,230 D107G probably damaging Het
Olfr127 T A 17: 37,903,770 S75T probably damaging Het
Olfr1280 T C 2: 111,315,998 V173A probably benign Het
Olfr401 C A 11: 74,121,431 S47R probably damaging Het
Olfr507 A C 7: 108,622,610 K266T possibly damaging Het
Osbp T C 19: 11,970,778 S150P probably damaging Het
Paf1 T C 7: 28,396,822 Y287H probably damaging Het
Pdgfrb T C 18: 61,068,102 V420A probably benign Het
Pdss1 G T 2: 22,906,834 E120* probably null Het
Pink1 A T 4: 138,317,319 V339E probably damaging Het
Pkn3 C T 2: 30,079,651 R58C probably damaging Het
Pm20d1 G A 1: 131,802,427 V235I probably benign Het
Ppp2r2a A G 14: 67,038,963 I31T probably damaging Het
Rbms3 T C 9: 116,822,826 E152G probably damaging Het
Rfx1 A C 8: 84,095,048 Q804H probably damaging Het
Rpe G T 1: 66,715,197 V143L probably benign Het
Sap30l G T 11: 57,809,945 V142L probably benign Het
Sh3tc1 T C 5: 35,705,924 Q973R probably benign Het
Slc10a2 T C 8: 5,104,856 T110A probably damaging Het
Snrnp200 A T 2: 127,219,027 probably null Het
Snrnp200 G A 2: 127,219,028 probably null Het
Spaca3 T A 11: 80,867,685 V158E probably damaging Het
Sprtn C A 8: 124,903,031 N354K probably benign Het
Stab1 T A 14: 31,141,144 Y2166F possibly damaging Het
Tmem106c G A 15: 97,968,667 probably null Het
Tnc A G 4: 63,999,931 S1248P probably damaging Het
Tshr T C 12: 91,537,316 F343L probably benign Het
Ttn C A 2: 76,725,354 A30436S probably damaging Het
Ubxn2a A T 12: 4,885,839 M68K probably benign Het
Ucp2 T C 7: 100,498,814 V238A probably damaging Het
Urgcp C A 11: 5,717,242 L365F probably damaging Het
Vezt A T 10: 93,990,164 D328E probably damaging Het
Vmn1r168 G T 7: 23,540,759 V14L probably benign Het
Vps13b T C 15: 35,792,059 F2158L probably benign Het
Other mutations in Npc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Npc1 APN 18 12199634 missense probably benign 0.45
IGL02523:Npc1 APN 18 12201572 missense probably benign 0.00
IGL03018:Npc1 APN 18 12214379 missense probably damaging 0.99
IGL03101:Npc1 APN 18 12198539 missense probably benign 0.15
IGL03151:Npc1 APN 18 12219275 missense probably benign 0.05
IGL03377:Npc1 APN 18 12211821 missense probably benign
PIT4354001:Npc1 UTSW 18 12211535 missense probably benign 0.00
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0190:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R0200:Npc1 UTSW 18 12219204 missense probably damaging 1.00
R0485:Npc1 UTSW 18 12213446 missense probably benign 0.00
R0699:Npc1 UTSW 18 12210575 missense probably benign 0.00
R0730:Npc1 UTSW 18 12219325 missense probably benign 0.00
R1302:Npc1 UTSW 18 12195085 missense probably benign 0.00
R1442:Npc1 UTSW 18 12195049 missense probably benign
R1463:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R1804:Npc1 UTSW 18 12223088 missense probably damaging 1.00
R1928:Npc1 UTSW 18 12213378 missense possibly damaging 0.79
R2112:Npc1 UTSW 18 12213472 missense possibly damaging 0.49
R2117:Npc1 UTSW 18 12196556 missense probably damaging 1.00
R2157:Npc1 UTSW 18 12191809 missense probably damaging 0.98
R2279:Npc1 UTSW 18 12197179 splice site probably null
R2311:Npc1 UTSW 18 12202183 missense probably benign
R2446:Npc1 UTSW 18 12214339 missense probably benign 0.01
R3004:Npc1 UTSW 18 12197254 missense probably benign 0.03
R4090:Npc1 UTSW 18 12198162 splice site probably null
R4304:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4308:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4564:Npc1 UTSW 18 12191732 missense probably damaging 1.00
R4786:Npc1 UTSW 18 12199497 missense probably benign 0.35
R5243:Npc1 UTSW 18 12198631 intron probably benign
R5404:Npc1 UTSW 18 12213299 missense possibly damaging 0.79
R5823:Npc1 UTSW 18 12191789 missense possibly damaging 0.69
R6080:Npc1 UTSW 18 12219351 missense probably damaging 1.00
R6215:Npc1 UTSW 18 12236192 small deletion probably benign
R6301:Npc1 UTSW 18 12197245 missense probably benign 0.00
R6476:Npc1 UTSW 18 12201694 nonsense probably null
R7007:Npc1 UTSW 18 12210548 missense probably benign 0.02
R7020:Npc1 UTSW 18 12198537 missense probably damaging 1.00
R7048:Npc1 UTSW 18 12204765 splice site probably null
R7116:Npc1 UTSW 18 12211544 missense probably damaging 1.00
R7153:Npc1 UTSW 18 12213291 missense possibly damaging 0.78
R7359:Npc1 UTSW 18 12195180 missense probably benign 0.05
R7382:Npc1 UTSW 18 12201706 missense probably damaging 0.99
X0012:Npc1 UTSW 18 12193311 unclassified probably null
Predicted Primers PCR Primer
(F):5'- CGAGTGTCTTAATGTCACTAGGC -3'
(R):5'- ACCTGACCATTATTGATGACACC -3'

Sequencing Primer
(F):5'- GTCTTAATGTCACTAGGCTACATGG -3'
(R):5'- GATGACACCATCTTTAACCTCAGTG -3'
Posted On2014-06-23