Incidental Mutation 'R1809:Tlr6'
ID203676
Institutional Source Beutler Lab
Gene Symbol Tlr6
Ensembl Gene ENSMUSG00000051498
Gene Nametoll-like receptor 6
Synonyms
MMRRC Submission 039838-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R1809 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location64952031-64960097 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 64953712 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 617 (C617*)
Ref Sequence ENSEMBL: ENSMUSP00000062096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062315] [ENSMUST00000201307]
Predicted Effect probably null
Transcript: ENSMUST00000062315
AA Change: C617*
SMART Domains Protein: ENSMUSP00000062096
Gene: ENSMUSG00000051498
AA Change: C617*

DomainStartEndE-ValueType
LRR_TYP 86 109 7.67e-2 SMART
LRR 131 155 2.76e1 SMART
LRR 461 482 6.23e1 SMART
LRR 483 507 4.57e0 SMART
LRRCT 540 594 4.06e-11 SMART
transmembrane domain 596 618 N/A INTRINSIC
TIR 652 795 5.37e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201307
SMART Domains Protein: ENSMUSP00000143865
Gene: ENSMUSG00000051498

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
LRR_TYP 86 109 3.3e-4 SMART
Meta Mutation Damage Score 0.626 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (107/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011]
PHENOTYPE: Inactivation of this gene results in abnormal macrophage function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930502E18Rik A G X: 53,733,749 E99G probably benign Het
9130409I23Rik T C 1: 181,059,687 I279T probably damaging Het
Ablim2 A G 5: 35,843,270 probably benign Het
Adamts20 C T 15: 94,341,087 S750N probably damaging Het
Adh6a G A 3: 138,330,961 R370H possibly damaging Het
Akr1b7 A G 6: 34,419,111 N183D probably damaging Het
Aktip A T 8: 91,129,720 I43N probably damaging Het
Ankrd26 A T 6: 118,525,922 probably benign Het
Ano9 G A 7: 141,108,804 T144I possibly damaging Het
Anpep G T 7: 79,841,823 D143E probably benign Het
Aox2 C A 1: 58,294,325 Q234K probably benign Het
Ap1g1 C G 8: 109,833,182 probably benign Het
Arhgef4 G A 1: 34,810,555 probably null Het
Armc4 T A 18: 7,211,630 Y748F probably benign Het
Arsj A G 3: 126,438,295 Y230C possibly damaging Het
Asmt C T X: 170,675,745 probably benign Het
Astl A T 2: 127,345,485 K72N probably damaging Het
Atp2b2 G A 6: 113,803,743 probably benign Het
Baiap2l1 A C 5: 144,324,555 probably null Het
C7 A T 15: 5,034,339 N193K probably damaging Het
Cacna2d4 G T 6: 119,270,824 R362L probably damaging Het
Cct4 T A 11: 22,997,615 D189E probably benign Het
Cd300lg G A 11: 102,043,112 G62S probably benign Het
Cdk14 T A 5: 5,010,901 M307L probably damaging Het
Cfi G A 3: 129,873,119 probably null Het
Clec2g G T 6: 128,980,310 probably null Het
Cntnap2 T C 6: 46,988,675 S807P probably damaging Het
Col6a3 T A 1: 90,827,949 H206L probably damaging Het
Cyp2c23 A T 19: 44,021,558 probably benign Het
Dlec1 T C 9: 119,136,699 V1058A probably benign Het
Dpp9 A G 17: 56,199,038 Y454H probably damaging Het
Drosha G A 15: 12,890,112 G920R probably null Het
Duox2 A G 2: 122,283,897 S1142P possibly damaging Het
Fam13a C T 6: 58,965,060 probably null Het
Filip1l A G 16: 57,506,660 R18G probably benign Het
Foxa1 A G 12: 57,542,741 V231A probably damaging Het
Gm11756 A G 4: 73,917,517 F237L probably benign Het
Gm4787 A T 12: 81,378,529 M285K possibly damaging Het
Gm5084 T A 13: 60,212,506 noncoding transcript Het
Gm6788 G A 19: 28,763,186 noncoding transcript Het
Gm9922 G T 14: 101,729,405 probably benign Het
Gtf3c4 A T 2: 28,833,976 Y440* probably null Het
Helq A G 5: 100,773,954 S795P probably damaging Het
Helz T A 11: 107,599,171 S151T possibly damaging Het
Irgm1 T C 11: 48,866,613 T124A probably benign Het
Itgam C T 7: 128,070,937 P134S possibly damaging Het
Kdm6a T C X: 18,236,684 Y217H probably benign Het
Kif6 T C 17: 49,901,784 L744P probably benign Het
Kmt2c C T 5: 25,284,192 R1203H probably damaging Het
Ksr2 A G 5: 117,555,470 T328A probably damaging Het
Lig1 T C 7: 13,300,355 probably benign Het
Lpar3 G A 3: 146,240,548 probably benign Het
Lrrk2 T C 15: 91,699,892 F285S possibly damaging Het
March7 A G 2: 60,232,293 D148G probably benign Het
Mcee T C 7: 64,400,301 L60S probably damaging Het
Mob2 A G 7: 142,016,374 I81T probably damaging Het
Mphosph8 T A 14: 56,672,452 D87E probably damaging Het
Myo1g T C 11: 6,512,283 T560A probably benign Het
Nagk C T 6: 83,797,187 T42I probably benign Het
Naip1 G T 13: 100,426,239 T806K probably benign Het
Ncor2 A G 5: 125,118,793 probably benign Het
Ocln G T 13: 100,511,459 Y401* probably null Het
Olfr922 G A 9: 38,816,147 V215I probably benign Het
Oma1 T A 4: 103,325,177 N292K probably damaging Het
Ovch2 T A 7: 107,790,205 probably null Het
Pcdhb16 T C 18: 37,478,388 F134L probably damaging Het
Pipox A T 11: 77,881,534 Y337N probably benign Het
Polr3b A G 10: 84,693,001 D763G probably damaging Het
Pygo1 T A 9: 72,944,796 N88K probably damaging Het
Rab3gap1 T C 1: 127,934,514 M674T probably damaging Het
Rbm25 T C 12: 83,672,727 probably benign Het
Rbm26 C T 14: 105,117,106 probably benign Het
Rbms2 G A 10: 128,138,186 T187I possibly damaging Het
Rnase11 T A 14: 51,049,727 R123S probably benign Het
Rngtt A G 4: 33,443,614 N485D probably benign Het
Rp1l1 A T 14: 64,027,966 M334L probably benign Het
Rps9 T A 7: 3,704,727 L56Q probably damaging Het
Saysd1 C A 14: 20,083,102 probably benign Het
Sema4d C T 13: 51,713,691 probably null Het
Shisa5 A T 9: 109,040,930 D34V probably damaging Het
Skil A G 3: 31,117,506 D547G probably damaging Het
Slc2a5 T A 4: 150,143,057 F444L probably damaging Het
Slc9b2 T G 3: 135,317,131 C10G possibly damaging Het
Sorcs2 G T 5: 36,229,220 probably benign Het
Stk17b T G 1: 53,765,981 K140N possibly damaging Het
Stradb T A 1: 58,994,390 L404Q possibly damaging Het
Synj2 T C 17: 6,026,551 M432T possibly damaging Het
Tanc1 G T 2: 59,800,097 R800L probably damaging Het
Tenm4 A G 7: 96,873,780 M1473V probably benign Het
Tesc A G 5: 118,061,602 I190V probably benign Het
Tex15 T C 8: 33,574,234 F1231L probably benign Het
Thrsp T C 7: 97,417,125 I127V probably benign Het
Trank1 A T 9: 111,392,825 I2877F probably benign Het
Ucp1 T C 8: 83,297,867 S274P probably damaging Het
Ucp2 T A 7: 100,498,399 V195E probably damaging Het
Vars2 T C 17: 35,662,216 T394A probably damaging Het
Vmn1r1 A G 1: 182,157,806 V98A possibly damaging Het
Vmn1r225 A G 17: 20,502,656 I120V probably benign Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r25 A G 6: 123,825,378 V522A probably benign Het
Vmn2r70 T C 7: 85,565,922 I135V probably benign Het
Vwf T C 6: 125,590,175 probably benign Het
Zcchc11 T A 4: 108,549,355 H1373Q probably damaging Het
Zfp446 T C 7: 12,979,121 F29L probably damaging Het
Other mutations in Tlr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Tlr6 APN 5 64953512 missense probably damaging 1.00
IGL00963:Tlr6 APN 5 64954676 missense possibly damaging 0.89
IGL01540:Tlr6 APN 5 64955286 missense probably damaging 0.97
IGL01675:Tlr6 APN 5 64954499 missense probably damaging 1.00
IGL01705:Tlr6 APN 5 64954130 missense probably benign 0.03
IGL02256:Tlr6 APN 5 64954944 missense probably benign 0.00
insouciant UTSW 5 64954583 missense possibly damaging 0.81
m2sd1 UTSW 5 64954194 nonsense
m2sd2 UTSW 5 64954394 nonsense
m2sd3 UTSW 5 64954241 missense probably damaging 0.98
R0336:Tlr6 UTSW 5 64953946 missense probably benign 0.02
R0388:Tlr6 UTSW 5 64955205 missense possibly damaging 0.74
R0558:Tlr6 UTSW 5 64954860 nonsense probably null
R0671:Tlr6 UTSW 5 64954592 missense probably benign 0.00
R1171:Tlr6 UTSW 5 64955250 missense probably benign 0.00
R1550:Tlr6 UTSW 5 64953411 missense probably damaging 0.98
R1868:Tlr6 UTSW 5 64954829 missense probably benign 0.00
R1876:Tlr6 UTSW 5 64955420 missense probably damaging 1.00
R1893:Tlr6 UTSW 5 64953213 missense probably damaging 1.00
R2006:Tlr6 UTSW 5 64953405 missense probably damaging 1.00
R2055:Tlr6 UTSW 5 64953926 missense probably damaging 1.00
R3087:Tlr6 UTSW 5 64954325 missense probably damaging 1.00
R3406:Tlr6 UTSW 5 64953429 missense probably damaging 1.00
R3711:Tlr6 UTSW 5 64953809 missense possibly damaging 0.75
R3938:Tlr6 UTSW 5 64953595 missense probably damaging 1.00
R3962:Tlr6 UTSW 5 64954985 missense probably benign 0.10
R4152:Tlr6 UTSW 5 64953212 missense probably damaging 1.00
R4274:Tlr6 UTSW 5 64953638 missense probably benign 0.01
R4516:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4518:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4762:Tlr6 UTSW 5 64954396 missense probably benign 0.09
R4959:Tlr6 UTSW 5 64953659 missense possibly damaging 0.81
R5119:Tlr6 UTSW 5 64954301 missense probably benign 0.06
R5248:Tlr6 UTSW 5 64955304 missense probably benign 0.30
R5507:Tlr6 UTSW 5 64953406 missense probably damaging 1.00
R5572:Tlr6 UTSW 5 64955018 missense probably damaging 1.00
R5773:Tlr6 UTSW 5 64954503 missense probably benign 0.00
R6711:Tlr6 UTSW 5 64954492 missense probably damaging 1.00
R7096:Tlr6 UTSW 5 64953776 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCAAACCCGGATGTCATC -3'
(R):5'- ACTTTGTCAAGAACATAGGCTGGG -3'

Sequencing Primer
(F):5'- AAACCCGGATGTCATCTTTCTCTAGG -3'
(R):5'- CTGGGTAGCAAGAGAAGTGGTG -3'
Posted On2014-06-23