Incidental Mutation 'R1809:Ksr2'
ID203678
Institutional Source Beutler Lab
Gene Symbol Ksr2
Ensembl Gene ENSMUSG00000061578
Gene Namekinase suppressor of ras 2
Synonyms
MMRRC Submission 039838-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1809 (G1)
Quality Score194
Status Validated
Chromosome5
Chromosomal Location117414000-117775003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117555470 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 328 (T328A)
Ref Sequence ENSEMBL: ENSMUSP00000137670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180430]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000073347
Predicted Effect probably damaging
Transcript: ENSMUST00000180430
AA Change: T328A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137670
Gene: ENSMUSG00000061578
AA Change: T328A

DomainStartEndE-ValueType
Pfam:KSR1-SAM 24 152 1.1e-45 PFAM
low complexity region 258 282 N/A INTRINSIC
low complexity region 326 341 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
C1 412 457 2.74e-8 SMART
low complexity region 518 551 N/A INTRINSIC
low complexity region 617 637 N/A INTRINSIC
Pfam:Pkinase 667 929 1.1e-41 PFAM
Pfam:Pkinase_Tyr 667 929 1.8e-46 PFAM
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (107/111)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit increased body fat and obesity, resulting from hyperphagia. Mice are also glucose intolerant and have high serum cholesterol, ALT, serum lipids and show hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930502E18Rik A G X: 53,733,749 E99G probably benign Het
9130409I23Rik T C 1: 181,059,687 I279T probably damaging Het
Ablim2 A G 5: 35,843,270 probably benign Het
Adamts20 C T 15: 94,341,087 S750N probably damaging Het
Adh6a G A 3: 138,330,961 R370H possibly damaging Het
Akr1b7 A G 6: 34,419,111 N183D probably damaging Het
Aktip A T 8: 91,129,720 I43N probably damaging Het
Ankrd26 A T 6: 118,525,922 probably benign Het
Ano9 G A 7: 141,108,804 T144I possibly damaging Het
Anpep G T 7: 79,841,823 D143E probably benign Het
Aox2 C A 1: 58,294,325 Q234K probably benign Het
Ap1g1 C G 8: 109,833,182 probably benign Het
Arhgef4 G A 1: 34,810,555 probably null Het
Armc4 T A 18: 7,211,630 Y748F probably benign Het
Arsj A G 3: 126,438,295 Y230C possibly damaging Het
Asmt C T X: 170,675,745 probably benign Het
Astl A T 2: 127,345,485 K72N probably damaging Het
Atp2b2 G A 6: 113,803,743 probably benign Het
Baiap2l1 A C 5: 144,324,555 probably null Het
C7 A T 15: 5,034,339 N193K probably damaging Het
Cacna2d4 G T 6: 119,270,824 R362L probably damaging Het
Cct4 T A 11: 22,997,615 D189E probably benign Het
Cd300lg G A 11: 102,043,112 G62S probably benign Het
Cdk14 T A 5: 5,010,901 M307L probably damaging Het
Cfi G A 3: 129,873,119 probably null Het
Clec2g G T 6: 128,980,310 probably null Het
Cntnap2 T C 6: 46,988,675 S807P probably damaging Het
Col6a3 T A 1: 90,827,949 H206L probably damaging Het
Cyp2c23 A T 19: 44,021,558 probably benign Het
Dlec1 T C 9: 119,136,699 V1058A probably benign Het
Dpp9 A G 17: 56,199,038 Y454H probably damaging Het
Drosha G A 15: 12,890,112 G920R probably null Het
Duox2 A G 2: 122,283,897 S1142P possibly damaging Het
Fam13a C T 6: 58,965,060 probably null Het
Filip1l A G 16: 57,506,660 R18G probably benign Het
Foxa1 A G 12: 57,542,741 V231A probably damaging Het
Gm11756 A G 4: 73,917,517 F237L probably benign Het
Gm4787 A T 12: 81,378,529 M285K possibly damaging Het
Gm5084 T A 13: 60,212,506 noncoding transcript Het
Gm6788 G A 19: 28,763,186 noncoding transcript Het
Gm9922 G T 14: 101,729,405 probably benign Het
Gtf3c4 A T 2: 28,833,976 Y440* probably null Het
Helq A G 5: 100,773,954 S795P probably damaging Het
Helz T A 11: 107,599,171 S151T possibly damaging Het
Irgm1 T C 11: 48,866,613 T124A probably benign Het
Itgam C T 7: 128,070,937 P134S possibly damaging Het
Kdm6a T C X: 18,236,684 Y217H probably benign Het
Kif6 T C 17: 49,901,784 L744P probably benign Het
Kmt2c C T 5: 25,284,192 R1203H probably damaging Het
Lig1 T C 7: 13,300,355 probably benign Het
Lpar3 G A 3: 146,240,548 probably benign Het
Lrrk2 T C 15: 91,699,892 F285S possibly damaging Het
March7 A G 2: 60,232,293 D148G probably benign Het
Mcee T C 7: 64,400,301 L60S probably damaging Het
Mob2 A G 7: 142,016,374 I81T probably damaging Het
Mphosph8 T A 14: 56,672,452 D87E probably damaging Het
Myo1g T C 11: 6,512,283 T560A probably benign Het
Nagk C T 6: 83,797,187 T42I probably benign Het
Naip1 G T 13: 100,426,239 T806K probably benign Het
Ncor2 A G 5: 125,118,793 probably benign Het
Ocln G T 13: 100,511,459 Y401* probably null Het
Olfr922 G A 9: 38,816,147 V215I probably benign Het
Oma1 T A 4: 103,325,177 N292K probably damaging Het
Ovch2 T A 7: 107,790,205 probably null Het
Pcdhb16 T C 18: 37,478,388 F134L probably damaging Het
Pipox A T 11: 77,881,534 Y337N probably benign Het
Polr3b A G 10: 84,693,001 D763G probably damaging Het
Pygo1 T A 9: 72,944,796 N88K probably damaging Het
Rab3gap1 T C 1: 127,934,514 M674T probably damaging Het
Rbm25 T C 12: 83,672,727 probably benign Het
Rbm26 C T 14: 105,117,106 probably benign Het
Rbms2 G A 10: 128,138,186 T187I possibly damaging Het
Rnase11 T A 14: 51,049,727 R123S probably benign Het
Rngtt A G 4: 33,443,614 N485D probably benign Het
Rp1l1 A T 14: 64,027,966 M334L probably benign Het
Rps9 T A 7: 3,704,727 L56Q probably damaging Het
Saysd1 C A 14: 20,083,102 probably benign Het
Sema4d C T 13: 51,713,691 probably null Het
Shisa5 A T 9: 109,040,930 D34V probably damaging Het
Skil A G 3: 31,117,506 D547G probably damaging Het
Slc2a5 T A 4: 150,143,057 F444L probably damaging Het
Slc9b2 T G 3: 135,317,131 C10G possibly damaging Het
Sorcs2 G T 5: 36,229,220 probably benign Het
Stk17b T G 1: 53,765,981 K140N possibly damaging Het
Stradb T A 1: 58,994,390 L404Q possibly damaging Het
Synj2 T C 17: 6,026,551 M432T possibly damaging Het
Tanc1 G T 2: 59,800,097 R800L probably damaging Het
Tenm4 A G 7: 96,873,780 M1473V probably benign Het
Tesc A G 5: 118,061,602 I190V probably benign Het
Tex15 T C 8: 33,574,234 F1231L probably benign Het
Thrsp T C 7: 97,417,125 I127V probably benign Het
Tlr6 A T 5: 64,953,712 C617* probably null Het
Trank1 A T 9: 111,392,825 I2877F probably benign Het
Ucp1 T C 8: 83,297,867 S274P probably damaging Het
Ucp2 T A 7: 100,498,399 V195E probably damaging Het
Vars2 T C 17: 35,662,216 T394A probably damaging Het
Vmn1r1 A G 1: 182,157,806 V98A possibly damaging Het
Vmn1r225 A G 17: 20,502,656 I120V probably benign Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r25 A G 6: 123,825,378 V522A probably benign Het
Vmn2r70 T C 7: 85,565,922 I135V probably benign Het
Vwf T C 6: 125,590,175 probably benign Het
Zcchc11 T A 4: 108,549,355 H1373Q probably damaging Het
Zfp446 T C 7: 12,979,121 F29L probably damaging Het
Other mutations in Ksr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Ksr2 APN 5 117616894 missense possibly damaging 0.52
IGL02231:Ksr2 APN 5 117500776 missense probably damaging 1.00
IGL02634:Ksr2 APN 5 117763329 splice site probably benign
IGL02669:Ksr2 APN 5 117555381 missense probably damaging 1.00
IGL03116:Ksr2 APN 5 117707957 missense probably benign 0.20
IGL03168:Ksr2 APN 5 117748781 missense probably damaging 1.00
IGL03372:Ksr2 APN 5 117702718 missense possibly damaging 0.93
gigante UTSW 5 117671449 missense probably damaging 0.99
R0133:Ksr2 UTSW 5 117555294 missense possibly damaging 0.95
R0811:Ksr2 UTSW 5 117555225 missense probably damaging 1.00
R0812:Ksr2 UTSW 5 117555225 missense probably damaging 1.00
R1162:Ksr2 UTSW 5 117554955 splice site probably benign
R1420:Ksr2 UTSW 5 117414839 missense probably benign 0.10
R1717:Ksr2 UTSW 5 117671449 missense probably damaging 0.99
R1859:Ksr2 UTSW 5 117414941 missense probably damaging 1.00
R1867:Ksr2 UTSW 5 117505529 missense probably benign 0.32
R1868:Ksr2 UTSW 5 117505529 missense probably benign 0.32
R3024:Ksr2 UTSW 5 117555060 missense possibly damaging 0.52
R3499:Ksr2 UTSW 5 117689575 missense probably damaging 1.00
R3687:Ksr2 UTSW 5 117554979 missense probably damaging 0.98
R3688:Ksr2 UTSW 5 117554979 missense probably damaging 0.98
R4044:Ksr2 UTSW 5 117555062 nonsense probably null
R4579:Ksr2 UTSW 5 117756270 missense probably damaging 0.99
R4697:Ksr2 UTSW 5 117708147 missense probably damaging 1.00
R4834:Ksr2 UTSW 5 117668327 missense probably benign 0.37
R5016:Ksr2 UTSW 5 117500792 missense probably benign 0.10
R5107:Ksr2 UTSW 5 117689608 missense probably benign 0.01
R5150:Ksr2 UTSW 5 117555009 missense probably damaging 0.97
R5326:Ksr2 UTSW 5 117708240 missense probably damaging 1.00
R5493:Ksr2 UTSW 5 117708110 missense probably damaging 1.00
R5738:Ksr2 UTSW 5 117748799 missense probably damaging 0.97
R6257:Ksr2 UTSW 5 117414844 missense probably benign 0.01
R6316:Ksr2 UTSW 5 117685502 missense probably damaging 1.00
R6389:Ksr2 UTSW 5 117414842 missense probably benign 0.09
R6460:Ksr2 UTSW 5 117756384 critical splice donor site probably null
R6874:Ksr2 UTSW 5 117756336 nonsense probably null
R6939:Ksr2 UTSW 5 117765561 makesense probably null
Z1088:Ksr2 UTSW 5 117747402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAATATTGTCACCACCGTG -3'
(R):5'- GGCCACAACTTAGATTCAGTTC -3'

Sequencing Primer
(F):5'- GTGACCCCACCTGGCAC -3'
(R):5'- CTCCAGAAATATCAAAGGCTATCGGG -3'
Posted On2014-06-23