Incidental Mutation 'R1809:Fam13a'
ID203685
Institutional Source Beutler Lab
Gene Symbol Fam13a
Ensembl Gene ENSMUSG00000037709
Gene Namefamily with sequence similarity 13, member A
SynonymsD430015B01Rik
MMRRC Submission 039838-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1809 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location58932090-59024549 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 58965060 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089860] [ENSMUST00000173193]
Predicted Effect probably null
Transcript: ENSMUST00000089860
SMART Domains Protein: ENSMUSP00000087304
Gene: ENSMUSG00000037709

DomainStartEndE-ValueType
Blast:RhoGAP 19 128 6e-27 BLAST
low complexity region 136 147 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 173 185 N/A INTRINSIC
coiled coil region 336 363 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
coiled coil region 620 645 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173193
SMART Domains Protein: ENSMUSP00000134135
Gene: ENSMUSG00000037709

DomainStartEndE-ValueType
Blast:RhoGAP 21 128 6e-27 BLAST
low complexity region 136 147 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 173 185 N/A INTRINSIC
coiled coil region 336 363 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
coiled coil region 592 617 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203293
Meta Mutation Damage Score 0.624 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (107/111)
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930502E18Rik A G X: 53,733,749 E99G probably benign Het
9130409I23Rik T C 1: 181,059,687 I279T probably damaging Het
Ablim2 A G 5: 35,843,270 probably benign Het
Adamts20 C T 15: 94,341,087 S750N probably damaging Het
Adh6a G A 3: 138,330,961 R370H possibly damaging Het
Akr1b7 A G 6: 34,419,111 N183D probably damaging Het
Aktip A T 8: 91,129,720 I43N probably damaging Het
Ankrd26 A T 6: 118,525,922 probably benign Het
Ano9 G A 7: 141,108,804 T144I possibly damaging Het
Anpep G T 7: 79,841,823 D143E probably benign Het
Aox2 C A 1: 58,294,325 Q234K probably benign Het
Ap1g1 C G 8: 109,833,182 probably benign Het
Arhgef4 G A 1: 34,810,555 probably null Het
Armc4 T A 18: 7,211,630 Y748F probably benign Het
Arsj A G 3: 126,438,295 Y230C possibly damaging Het
Asmt C T X: 170,675,745 probably benign Het
Astl A T 2: 127,345,485 K72N probably damaging Het
Atp2b2 G A 6: 113,803,743 probably benign Het
Baiap2l1 A C 5: 144,324,555 probably null Het
C7 A T 15: 5,034,339 N193K probably damaging Het
Cacna2d4 G T 6: 119,270,824 R362L probably damaging Het
Cct4 T A 11: 22,997,615 D189E probably benign Het
Cd300lg G A 11: 102,043,112 G62S probably benign Het
Cdk14 T A 5: 5,010,901 M307L probably damaging Het
Cfi G A 3: 129,873,119 probably null Het
Clec2g G T 6: 128,980,310 probably null Het
Cntnap2 T C 6: 46,988,675 S807P probably damaging Het
Col6a3 T A 1: 90,827,949 H206L probably damaging Het
Cyp2c23 A T 19: 44,021,558 probably benign Het
Dlec1 T C 9: 119,136,699 V1058A probably benign Het
Dpp9 A G 17: 56,199,038 Y454H probably damaging Het
Drosha G A 15: 12,890,112 G920R probably null Het
Duox2 A G 2: 122,283,897 S1142P possibly damaging Het
Filip1l A G 16: 57,506,660 R18G probably benign Het
Foxa1 A G 12: 57,542,741 V231A probably damaging Het
Gm11756 A G 4: 73,917,517 F237L probably benign Het
Gm4787 A T 12: 81,378,529 M285K possibly damaging Het
Gm5084 T A 13: 60,212,506 noncoding transcript Het
Gm6788 G A 19: 28,763,186 noncoding transcript Het
Gm9922 G T 14: 101,729,405 probably benign Het
Gtf3c4 A T 2: 28,833,976 Y440* probably null Het
Helq A G 5: 100,773,954 S795P probably damaging Het
Helz T A 11: 107,599,171 S151T possibly damaging Het
Irgm1 T C 11: 48,866,613 T124A probably benign Het
Itgam C T 7: 128,070,937 P134S possibly damaging Het
Kdm6a T C X: 18,236,684 Y217H probably benign Het
Kif6 T C 17: 49,901,784 L744P probably benign Het
Kmt2c C T 5: 25,284,192 R1203H probably damaging Het
Ksr2 A G 5: 117,555,470 T328A probably damaging Het
Lig1 T C 7: 13,300,355 probably benign Het
Lpar3 G A 3: 146,240,548 probably benign Het
Lrrk2 T C 15: 91,699,892 F285S possibly damaging Het
March7 A G 2: 60,232,293 D148G probably benign Het
Mcee T C 7: 64,400,301 L60S probably damaging Het
Mob2 A G 7: 142,016,374 I81T probably damaging Het
Mphosph8 T A 14: 56,672,452 D87E probably damaging Het
Myo1g T C 11: 6,512,283 T560A probably benign Het
Nagk C T 6: 83,797,187 T42I probably benign Het
Naip1 G T 13: 100,426,239 T806K probably benign Het
Ncor2 A G 5: 125,118,793 probably benign Het
Ocln G T 13: 100,511,459 Y401* probably null Het
Olfr922 G A 9: 38,816,147 V215I probably benign Het
Oma1 T A 4: 103,325,177 N292K probably damaging Het
Ovch2 T A 7: 107,790,205 probably null Het
Pcdhb16 T C 18: 37,478,388 F134L probably damaging Het
Pipox A T 11: 77,881,534 Y337N probably benign Het
Polr3b A G 10: 84,693,001 D763G probably damaging Het
Pygo1 T A 9: 72,944,796 N88K probably damaging Het
Rab3gap1 T C 1: 127,934,514 M674T probably damaging Het
Rbm25 T C 12: 83,672,727 probably benign Het
Rbm26 C T 14: 105,117,106 probably benign Het
Rbms2 G A 10: 128,138,186 T187I possibly damaging Het
Rnase11 T A 14: 51,049,727 R123S probably benign Het
Rngtt A G 4: 33,443,614 N485D probably benign Het
Rp1l1 A T 14: 64,027,966 M334L probably benign Het
Rps9 T A 7: 3,704,727 L56Q probably damaging Het
Saysd1 C A 14: 20,083,102 probably benign Het
Sema4d C T 13: 51,713,691 probably null Het
Shisa5 A T 9: 109,040,930 D34V probably damaging Het
Skil A G 3: 31,117,506 D547G probably damaging Het
Slc2a5 T A 4: 150,143,057 F444L probably damaging Het
Slc9b2 T G 3: 135,317,131 C10G possibly damaging Het
Sorcs2 G T 5: 36,229,220 probably benign Het
Stk17b T G 1: 53,765,981 K140N possibly damaging Het
Stradb T A 1: 58,994,390 L404Q possibly damaging Het
Synj2 T C 17: 6,026,551 M432T possibly damaging Het
Tanc1 G T 2: 59,800,097 R800L probably damaging Het
Tenm4 A G 7: 96,873,780 M1473V probably benign Het
Tesc A G 5: 118,061,602 I190V probably benign Het
Tex15 T C 8: 33,574,234 F1231L probably benign Het
Thrsp T C 7: 97,417,125 I127V probably benign Het
Tlr6 A T 5: 64,953,712 C617* probably null Het
Trank1 A T 9: 111,392,825 I2877F probably benign Het
Ucp1 T C 8: 83,297,867 S274P probably damaging Het
Ucp2 T A 7: 100,498,399 V195E probably damaging Het
Vars2 T C 17: 35,662,216 T394A probably damaging Het
Vmn1r1 A G 1: 182,157,806 V98A possibly damaging Het
Vmn1r225 A G 17: 20,502,656 I120V probably benign Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r25 A G 6: 123,825,378 V522A probably benign Het
Vmn2r70 T C 7: 85,565,922 I135V probably benign Het
Vwf T C 6: 125,590,175 probably benign Het
Zcchc11 T A 4: 108,549,355 H1373Q probably damaging Het
Zfp446 T C 7: 12,979,121 F29L probably damaging Het
Other mutations in Fam13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Fam13a APN 6 58946126 missense probably benign 0.03
IGL00467:Fam13a APN 6 58940113 splice site probably benign
IGL01288:Fam13a APN 6 58956727 missense probably damaging 1.00
IGL01503:Fam13a APN 6 58956080 missense probably damaging 1.00
IGL01532:Fam13a APN 6 58940295 missense probably damaging 0.96
IGL02197:Fam13a APN 6 58935601 missense possibly damaging 0.65
IGL02206:Fam13a APN 6 58987219 missense probably benign 0.00
IGL03189:Fam13a APN 6 58956858 missense probably damaging 0.99
R0361:Fam13a UTSW 6 58987174 missense probably benign
R0512:Fam13a UTSW 6 58956699 missense probably damaging 1.00
R0801:Fam13a UTSW 6 58984012 missense probably benign 0.01
R1222:Fam13a UTSW 6 58935722 splice site probably benign
R1378:Fam13a UTSW 6 58956751 missense probably benign 0.04
R1535:Fam13a UTSW 6 58939347 missense probably damaging 0.99
R1614:Fam13a UTSW 6 58940184 missense probably damaging 1.00
R1663:Fam13a UTSW 6 58954372 nonsense probably null
R1905:Fam13a UTSW 6 58953490 missense probably damaging 1.00
R2568:Fam13a UTSW 6 58935609 missense probably damaging 1.00
R3771:Fam13a UTSW 6 58987186 missense probably benign 0.11
R4654:Fam13a UTSW 6 58987167 missense probably benign
R5244:Fam13a UTSW 6 58953474 nonsense probably null
R5488:Fam13a UTSW 6 59024318 missense probably null 1.00
R5489:Fam13a UTSW 6 59024318 missense probably null 1.00
R5712:Fam13a UTSW 6 58956699 missense probably damaging 1.00
R5729:Fam13a UTSW 6 58939307 missense probably damaging 0.99
R5969:Fam13a UTSW 6 58965198 missense probably damaging 1.00
R6074:Fam13a UTSW 6 58989738 splice site probably null
R6275:Fam13a UTSW 6 58954257 missense probably damaging 0.98
R6306:Fam13a UTSW 6 58940254 missense probably benign 0.02
R6338:Fam13a UTSW 6 58953499 missense probably damaging 1.00
R6603:Fam13a UTSW 6 58987189 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGTATTGCAACTACCCTTGGC -3'
(R):5'- ACAGTAGCTATTAGGGCACACTG -3'

Sequencing Primer
(F):5'- ACAGCATGTTCCTATGCCTGGTAAG -3'
(R):5'- GAGCATCCCAGTCTATCT -3'
Posted On2014-06-23