Incidental Mutation 'R1809:Lrrk2'
ID203741
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Nameleucine-rich repeat kinase 2
Synonyms9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik
MMRRC Submission 039838-MU
Accession Numbers

Genbank: NM_025730; MGI: 1913975

Is this an essential gene? Possibly essential (E-score: 0.542) question?
Stock #R1809 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location91673175-91816120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91699892 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 285 (F285S)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060642
AA Change: F285S

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: F285S

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (107/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930502E18Rik A G X: 53,733,749 E99G probably benign Het
9130409I23Rik T C 1: 181,059,687 I279T probably damaging Het
Ablim2 A G 5: 35,843,270 probably benign Het
Adamts20 C T 15: 94,341,087 S750N probably damaging Het
Adh6a G A 3: 138,330,961 R370H possibly damaging Het
Akr1b7 A G 6: 34,419,111 N183D probably damaging Het
Aktip A T 8: 91,129,720 I43N probably damaging Het
Ankrd26 A T 6: 118,525,922 probably benign Het
Ano9 G A 7: 141,108,804 T144I possibly damaging Het
Anpep G T 7: 79,841,823 D143E probably benign Het
Aox2 C A 1: 58,294,325 Q234K probably benign Het
Ap1g1 C G 8: 109,833,182 probably benign Het
Arhgef4 G A 1: 34,810,555 probably null Het
Armc4 T A 18: 7,211,630 Y748F probably benign Het
Arsj A G 3: 126,438,295 Y230C possibly damaging Het
Asmt C T X: 170,675,745 probably benign Het
Astl A T 2: 127,345,485 K72N probably damaging Het
Atp2b2 G A 6: 113,803,743 probably benign Het
Baiap2l1 A C 5: 144,324,555 probably null Het
C7 A T 15: 5,034,339 N193K probably damaging Het
Cacna2d4 G T 6: 119,270,824 R362L probably damaging Het
Cct4 T A 11: 22,997,615 D189E probably benign Het
Cd300lg G A 11: 102,043,112 G62S probably benign Het
Cdk14 T A 5: 5,010,901 M307L probably damaging Het
Cfi G A 3: 129,873,119 probably null Het
Clec2g G T 6: 128,980,310 probably null Het
Cntnap2 T C 6: 46,988,675 S807P probably damaging Het
Col6a3 T A 1: 90,827,949 H206L probably damaging Het
Cyp2c23 A T 19: 44,021,558 probably benign Het
Dlec1 T C 9: 119,136,699 V1058A probably benign Het
Dpp9 A G 17: 56,199,038 Y454H probably damaging Het
Drosha G A 15: 12,890,112 G920R probably null Het
Duox2 A G 2: 122,283,897 S1142P possibly damaging Het
Fam13a C T 6: 58,965,060 probably null Het
Filip1l A G 16: 57,506,660 R18G probably benign Het
Foxa1 A G 12: 57,542,741 V231A probably damaging Het
Gm11756 A G 4: 73,917,517 F237L probably benign Het
Gm4787 A T 12: 81,378,529 M285K possibly damaging Het
Gm5084 T A 13: 60,212,506 noncoding transcript Het
Gm6788 G A 19: 28,763,186 noncoding transcript Het
Gm9922 G T 14: 101,729,405 probably benign Het
Gtf3c4 A T 2: 28,833,976 Y440* probably null Het
Helq A G 5: 100,773,954 S795P probably damaging Het
Helz T A 11: 107,599,171 S151T possibly damaging Het
Irgm1 T C 11: 48,866,613 T124A probably benign Het
Itgam C T 7: 128,070,937 P134S possibly damaging Het
Kdm6a T C X: 18,236,684 Y217H probably benign Het
Kif6 T C 17: 49,901,784 L744P probably benign Het
Kmt2c C T 5: 25,284,192 R1203H probably damaging Het
Ksr2 A G 5: 117,555,470 T328A probably damaging Het
Lig1 T C 7: 13,300,355 probably benign Het
Lpar3 G A 3: 146,240,548 probably benign Het
March7 A G 2: 60,232,293 D148G probably benign Het
Mcee T C 7: 64,400,301 L60S probably damaging Het
Mob2 A G 7: 142,016,374 I81T probably damaging Het
Mphosph8 T A 14: 56,672,452 D87E probably damaging Het
Myo1g T C 11: 6,512,283 T560A probably benign Het
Nagk C T 6: 83,797,187 T42I probably benign Het
Naip1 G T 13: 100,426,239 T806K probably benign Het
Ncor2 A G 5: 125,118,793 probably benign Het
Ocln G T 13: 100,511,459 Y401* probably null Het
Olfr922 G A 9: 38,816,147 V215I probably benign Het
Oma1 T A 4: 103,325,177 N292K probably damaging Het
Ovch2 T A 7: 107,790,205 probably null Het
Pcdhb16 T C 18: 37,478,388 F134L probably damaging Het
Pipox A T 11: 77,881,534 Y337N probably benign Het
Polr3b A G 10: 84,693,001 D763G probably damaging Het
Pygo1 T A 9: 72,944,796 N88K probably damaging Het
Rab3gap1 T C 1: 127,934,514 M674T probably damaging Het
Rbm25 T C 12: 83,672,727 probably benign Het
Rbm26 C T 14: 105,117,106 probably benign Het
Rbms2 G A 10: 128,138,186 T187I possibly damaging Het
Rnase11 T A 14: 51,049,727 R123S probably benign Het
Rngtt A G 4: 33,443,614 N485D probably benign Het
Rp1l1 A T 14: 64,027,966 M334L probably benign Het
Rps9 T A 7: 3,704,727 L56Q probably damaging Het
Saysd1 C A 14: 20,083,102 probably benign Het
Sema4d C T 13: 51,713,691 probably null Het
Shisa5 A T 9: 109,040,930 D34V probably damaging Het
Skil A G 3: 31,117,506 D547G probably damaging Het
Slc2a5 T A 4: 150,143,057 F444L probably damaging Het
Slc9b2 T G 3: 135,317,131 C10G possibly damaging Het
Sorcs2 G T 5: 36,229,220 probably benign Het
Stk17b T G 1: 53,765,981 K140N possibly damaging Het
Stradb T A 1: 58,994,390 L404Q possibly damaging Het
Synj2 T C 17: 6,026,551 M432T possibly damaging Het
Tanc1 G T 2: 59,800,097 R800L probably damaging Het
Tenm4 A G 7: 96,873,780 M1473V probably benign Het
Tesc A G 5: 118,061,602 I190V probably benign Het
Tex15 T C 8: 33,574,234 F1231L probably benign Het
Thrsp T C 7: 97,417,125 I127V probably benign Het
Tlr6 A T 5: 64,953,712 C617* probably null Het
Trank1 A T 9: 111,392,825 I2877F probably benign Het
Ucp1 T C 8: 83,297,867 S274P probably damaging Het
Ucp2 T A 7: 100,498,399 V195E probably damaging Het
Vars2 T C 17: 35,662,216 T394A probably damaging Het
Vmn1r1 A G 1: 182,157,806 V98A possibly damaging Het
Vmn1r225 A G 17: 20,502,656 I120V probably benign Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r25 A G 6: 123,825,378 V522A probably benign Het
Vmn2r70 T C 7: 85,565,922 I135V probably benign Het
Vwf T C 6: 125,590,175 probably benign Het
Zcchc11 T A 4: 108,549,355 H1373Q probably damaging Het
Zfp446 T C 7: 12,979,121 F29L probably damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91747799 missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91699943 missense probably benign
IGL00770:Lrrk2 APN 15 91801833 splice site probably benign
IGL00774:Lrrk2 APN 15 91801833 splice site probably benign
IGL00791:Lrrk2 APN 15 91779841 missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91755790 missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91757058 missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91738832 missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91726137 missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91683142 missense probably benign
IGL01301:Lrrk2 APN 15 91767339 missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91700569 splice site probably null
IGL01465:Lrrk2 APN 15 91728925 missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91812313 missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91699989 missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91774988 missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91779946 missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91731491 missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91726308 critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91685822 missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91750277 missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91747755 missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91700578 missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91797414 splice site probably null
3-1:Lrrk2 UTSW 15 91801934 missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91767339 missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91673358 missense probably benign
H8786:Lrrk2 UTSW 15 91673358 missense probably benign
IGL02835:Lrrk2 UTSW 15 91814660 critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0078:Lrrk2 UTSW 15 91734009 missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91745796 missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91778414 splice site probably benign
R0448:Lrrk2 UTSW 15 91709305 missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91750275 missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91815416 missense probably benign
R0617:Lrrk2 UTSW 15 91752278 missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91796028 missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91772996 missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91757070 critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91775046 splice site probably null
R0766:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91755962 missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91729081 missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91729169 missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91673689 missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91700468 nonsense probably null
R1223:Lrrk2 UTSW 15 91673635 missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91812360 missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91728920 missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91734058 missense probably benign
R1773:Lrrk2 UTSW 15 91779981 missense possibly damaging 0.96
R1839:Lrrk2 UTSW 15 91683134 missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91736661 splice site probably null
R2160:Lrrk2 UTSW 15 91796060 missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91764716 missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91797526 splice site probably benign
R2516:Lrrk2 UTSW 15 91755927 missense probably benign
R3110:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91737111 missense probably benign
R3842:Lrrk2 UTSW 15 91755916 missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91747700 missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91747701 missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91767461 critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91712780 missense possibly damaging 0.69
R3938:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3982:Lrrk2 UTSW 15 91709284 missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91815483 missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91755794 missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91747820 missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91723188 missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91705120 missense probably benign
R4539:Lrrk2 UTSW 15 91729142 missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91765681 missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91699927 missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91688901 missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91764759 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91712828 missense probably benign
R4945:Lrrk2 UTSW 15 91804920 missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91803389 missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91749878 missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91700619 missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91765790 missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91796089 missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91814644 intron probably null
R5551:Lrrk2 UTSW 15 91812350 missense probably benign
R5574:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91765745 missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91803301 nonsense probably null
R5712:Lrrk2 UTSW 15 91702222 nonsense probably null
R5728:Lrrk2 UTSW 15 91774974 missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91702183 missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91764648 missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91709390 critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91755949 missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91734046 missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91745831 missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91772945 missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91723135 missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91747826 missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91702247 missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91742266 missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91723218 missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91774995 nonsense probably null
R7072:Lrrk2 UTSW 15 91801920 missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91764782 missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91801885 missense probably benign
R7144:Lrrk2 UTSW 15 91734055 missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91757001 missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91700441 missense probably benign 0.01
X0028:Lrrk2 UTSW 15 91738851 missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91726240 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCTTACTCAGCCAGCAAAGTC -3'
(R):5'- CTGGAAGAAGGTCCTTTAACCCTC -3'

Sequencing Primer
(F):5'- CCAGAGTTTCAAAAAGTCTCTTGC -3'
(R):5'- TTTAACCCTCAACACTTAAAAGGAG -3'
Posted On2014-06-23