Incidental Mutation 'R1860:Scn1a'
ID203765
Institutional Source Beutler Lab
Gene Symbol Scn1a
Ensembl Gene ENSMUSG00000064329
Gene Namesodium channel, voltage-gated, type I, alpha
SynonymsNav1.1
MMRRC Submission 039883-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1860 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location66270778-66440840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66317982 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 1073 (S1073N)
Ref Sequence ENSEMBL: ENSMUSP00000107990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000156865]
Predicted Effect probably damaging
Transcript: ENSMUST00000077489
AA Change: S1073N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: S1073N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094951
AA Change: S1056N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: S1056N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.3e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 691 2e-62 PFAM
Pfam:Ion_trans 774 963 6.7e-47 PFAM
Pfam:Na_trans_assoc 978 1200 1.2e-74 PFAM
Pfam:Ion_trans 1226 1454 1e-56 PFAM
PDB:1BYY|A 1456 1508 4e-31 PDB
Pfam:Ion_trans 1547 1757 1.1e-51 PFAM
Pfam:PKD_channel 1606 1764 3.8e-7 PFAM
low complexity region 1809 1821 N/A INTRINSIC
IQ 1886 1908 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112366
AA Change: S1084N

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: S1084N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 127 434 2.8e-82 PFAM
Pfam:Na_trans_cytopl 502 718 2e-91 PFAM
Pfam:Ion_trans 767 1002 6.5e-57 PFAM
Pfam:Na_trans_assoc 1006 1213 1.2e-60 PFAM
Pfam:Ion_trans 1217 1493 3.3e-67 PFAM
Pfam:Ion_trans 1540 1797 6.3e-56 PFAM
Pfam:PKD_channel 1637 1791 1.1e-6 PFAM
low complexity region 1837 1849 N/A INTRINSIC
IQ 1914 1936 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112371
AA Change: S1073N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: S1073N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000156865
AA Change: S53N

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144633
Gene: ENSMUSG00000064329
AA Change: S53N

DomainStartEndE-ValueType
Pfam:Na_trans_assoc 1 182 2.2e-44 PFAM
Pfam:Ion_trans 186 462 1.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200839
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,232 C587R probably damaging Het
Abca16 T A 7: 120,534,763 S1320T probably benign Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Acadsb T A 7: 131,444,229 probably null Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Adgre1 T C 17: 57,441,363 V521A probably benign Het
Adh5 G A 3: 138,453,778 V288I probably benign Het
Astn1 A C 1: 158,601,945 N753T probably damaging Het
Atad2 A T 15: 58,096,718 probably null Het
Best3 A G 10: 116,993,273 T153A probably damaging Het
Ccdc122 G A 14: 77,111,407 V226I probably damaging Het
Ccdc175 T C 12: 72,105,926 Q735R probably benign Het
Cd19 T A 7: 126,409,641 I499F probably damaging Het
Cftr T A 6: 18,268,289 L749H probably benign Het
Clec2h G T 6: 128,675,827 G186W probably damaging Het
Cpsf3 T A 12: 21,296,732 I202N probably damaging Het
Crebbp G T 16: 4,087,736 T1669N possibly damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cul4a G A 8: 13,123,565 R204Q probably damaging Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Derl2 A G 11: 71,018,343 F43S probably damaging Het
Dnah14 T A 1: 181,763,960 N3348K probably damaging Het
Dnhd1 T C 7: 105,704,205 V2855A probably benign Het
Dpysl4 G T 7: 139,090,299 C27F probably benign Het
Fam228b G A 12: 4,748,314 A163V probably damaging Het
Fscn1 T C 5: 142,970,063 probably null Het
Fzd5 C A 1: 64,734,994 R536L probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gpr176 T A 2: 118,373,178 N4Y probably damaging Het
Grin3a T C 4: 49,665,309 I1109V possibly damaging Het
H2afy A G 13: 56,083,204 L287P probably damaging Het
Hcar1 T A 5: 123,879,029 I200F probably damaging Het
Heatr4 G A 12: 83,979,728 Q252* probably null Het
Hps1 G A 19: 42,762,449 H371Y probably damaging Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Kdm1b G A 13: 47,049,190 A34T probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Ltn1 A T 16: 87,416,343 D443E probably benign Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mb A G 15: 77,017,584 Y104H probably damaging Het
Mrc1 C A 2: 14,328,579 P1357Q probably benign Het
Nfib C T 4: 82,323,680 V425M probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1262 G A 2: 90,003,146 V247I probably benign Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr473 A G 7: 107,934,390 Y290C probably damaging Het
Olfr527 G A 7: 140,336,219 R119H possibly damaging Het
Olfr654 T C 7: 104,587,905 S34P probably damaging Het
Olfr732 A T 14: 50,281,391 Y287* probably null Het
Olfr784 T C 10: 129,388,086 F151S probably damaging Het
Olfr916 A T 9: 38,658,365 V9E probably damaging Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Prkaca T C 8: 83,981,223 S46P probably benign Het
Prkcb T G 7: 122,568,201 V378G probably damaging Het
Ptprf A T 4: 118,223,932 L576Q probably damaging Het
Rapgef4 T C 2: 72,234,720 V687A probably benign Het
Rsad2 C T 12: 26,450,617 V224I probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Slc26a3 A G 12: 31,465,846 M582V probably benign Het
Tbc1d32 A T 10: 56,123,537 Y846* probably null Het
Tbk1 A T 10: 121,547,171 M719K probably benign Het
Timeless A G 10: 128,246,114 K536R probably benign Het
Tle6 G T 10: 81,594,329 Q330K probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Toe1 T C 4: 116,805,229 Y273C probably damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ubxn11 G A 4: 134,124,838 S32N probably damaging Het
Usp8 G A 2: 126,756,040 C961Y probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r124 G T 17: 18,049,497 W5L probably benign Het
Vmn2r71 A T 7: 85,615,574 D38V probably damaging Het
Vmn2r87 C T 10: 130,479,886 V104I probably benign Het
Vmn2r97 C T 17: 18,947,386 T634I probably benign Het
Vps50 T C 6: 3,520,279 probably null Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Zfp14 C T 7: 30,038,691 V290M probably damaging Het
Zfp317 G A 9: 19,641,984 A18T possibly damaging Het
Zfp354b A T 11: 50,923,542 N185K probably benign Het
Zscan21 T A 5: 138,126,630 D269E probably benign Het
Other mutations in Scn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Scn1a APN 2 66335531 critical splice acceptor site probably null
IGL00650:Scn1a APN 2 66280793 missense probably damaging 1.00
IGL00658:Scn1a APN 2 66286038 missense probably damaging 1.00
IGL00823:Scn1a APN 2 66324935 missense probably benign 0.04
IGL00907:Scn1a APN 2 66327797 missense probably damaging 1.00
IGL01339:Scn1a APN 2 66325960 missense probably benign 0.09
IGL01401:Scn1a APN 2 66289111 missense probably damaging 1.00
IGL01503:Scn1a APN 2 66322343 missense probably damaging 1.00
IGL01575:Scn1a APN 2 66273236 missense probably damaging 1.00
IGL01598:Scn1a APN 2 66302485 missense possibly damaging 0.63
IGL01613:Scn1a APN 2 66285937 missense probably damaging 1.00
IGL01796:Scn1a APN 2 66332301 splice site probably benign
IGL02079:Scn1a APN 2 66323360 missense probably benign 0.14
IGL02171:Scn1a APN 2 66273199 missense probably damaging 1.00
IGL02335:Scn1a APN 2 66277661 missense possibly damaging 0.93
IGL02406:Scn1a APN 2 66326036 missense possibly damaging 0.88
IGL02436:Scn1a APN 2 66351153 missense probably benign 0.01
IGL02507:Scn1a APN 2 66277813 missense probably damaging 1.00
IGL02646:Scn1a APN 2 66299618 splice site probably null
IGL02729:Scn1a APN 2 66299650 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66324762 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66318077 missense probably benign 0.00
IGL02752:Scn1a APN 2 66331412 missense probably damaging 1.00
IGL02815:Scn1a APN 2 66324858 missense probably damaging 1.00
IGL03163:Scn1a APN 2 66318074 missense probably benign 0.00
IGL03229:Scn1a APN 2 66299713 missense probably damaging 1.00
IGL03286:Scn1a APN 2 66277576 missense probably damaging 0.99
IGL03393:Scn1a APN 2 66318018 missense probably benign 0.19
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0107:Scn1a UTSW 2 66324633 missense probably benign 0.07
R0141:Scn1a UTSW 2 66289062 missense probably damaging 1.00
R0485:Scn1a UTSW 2 66273925 missense probably damaging 0.98
R0517:Scn1a UTSW 2 66302407 missense possibly damaging 0.88
R0532:Scn1a UTSW 2 66317823 missense probably damaging 1.00
R0746:Scn1a UTSW 2 66351126 missense probably benign 0.25
R0755:Scn1a UTSW 2 66321035 missense probably damaging 1.00
R0830:Scn1a UTSW 2 66299784 missense probably damaging 1.00
R0846:Scn1a UTSW 2 66324755 missense probably benign 0.43
R0918:Scn1a UTSW 2 66323307 splice site probably null
R1055:Scn1a UTSW 2 66337996 missense probably benign 0.08
R1432:Scn1a UTSW 2 66322429 missense probably damaging 1.00
R1497:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R1512:Scn1a UTSW 2 66331285 missense possibly damaging 0.82
R1525:Scn1a UTSW 2 66319462 nonsense probably null
R1567:Scn1a UTSW 2 66273331 missense probably damaging 1.00
R1702:Scn1a UTSW 2 66318223 missense probably damaging 1.00
R1744:Scn1a UTSW 2 66322276 missense probably benign 0.06
R1834:Scn1a UTSW 2 66324616 missense probably benign 0.04
R1834:Scn1a UTSW 2 66324617 missense probably benign 0.00
R1871:Scn1a UTSW 2 66318025 missense probably damaging 0.98
R1909:Scn1a UTSW 2 66331352 missense possibly damaging 0.58
R1967:Scn1a UTSW 2 66328425 missense probably damaging 1.00
R1976:Scn1a UTSW 2 66331271 missense probably benign 0.02
R2291:Scn1a UTSW 2 66288968 missense probably benign 0.44
R2302:Scn1a UTSW 2 66277745 missense probably damaging 1.00
R2367:Scn1a UTSW 2 66327679 missense probably damaging 1.00
R2418:Scn1a UTSW 2 66273843 missense probably damaging 0.98
R2517:Scn1a UTSW 2 66273832 missense probably damaging 1.00
R2568:Scn1a UTSW 2 66273469 missense probably damaging 1.00
R3083:Scn1a UTSW 2 66299637 missense probably damaging 1.00
R3903:Scn1a UTSW 2 66318132 missense probably benign 0.08
R3909:Scn1a UTSW 2 66273988 missense probably damaging 1.00
R3916:Scn1a UTSW 2 66277613 missense probably damaging 1.00
R3935:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R3936:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R4043:Scn1a UTSW 2 66326036 missense possibly damaging 0.60
R4429:Scn1a UTSW 2 66350985 missense possibly damaging 0.77
R4495:Scn1a UTSW 2 66280802 critical splice acceptor site probably null
R4662:Scn1a UTSW 2 66350988 missense probably benign 0.23
R4834:Scn1a UTSW 2 66328522 nonsense probably null
R4873:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R4875:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R5099:Scn1a UTSW 2 66277801 missense probably damaging 1.00
R5255:Scn1a UTSW 2 66277669 missense probably damaging 0.99
R5435:Scn1a UTSW 2 66273534 missense probably damaging 1.00
R5449:Scn1a UTSW 2 66321002 missense probably damaging 0.96
R5519:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R5541:Scn1a UTSW 2 66324633 missense probably benign 0.07
R5556:Scn1a UTSW 2 66324797 missense probably benign 0.00
R5587:Scn1a UTSW 2 66273081 missense probably benign 0.01
R5972:Scn1a UTSW 2 66351110 missense possibly damaging 0.65
R5992:Scn1a UTSW 2 66335456 missense probably damaging 1.00
R6195:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6233:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6328:Scn1a UTSW 2 66273316 missense probably damaging 1.00
R6417:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6420:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6421:Scn1a UTSW 2 66272927 missense probably damaging 1.00
R6461:Scn1a UTSW 2 66326122 missense probably null 0.01
R6701:Scn1a UTSW 2 66337960 missense probably damaging 0.99
R6717:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R6834:Scn1a UTSW 2 66327742 missense probably damaging 1.00
R6918:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R6953:Scn1a UTSW 2 66319469 missense probably damaging 1.00
R6996:Scn1a UTSW 2 66287731 missense probably damaging 1.00
R7022:Scn1a UTSW 2 66317899 missense probably damaging 1.00
R7109:Scn1a UTSW 2 66350942 missense not run
R7115:Scn1a UTSW 2 66324618 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGCATTCATCTCCCTGAG -3'
(R):5'- GATTGCTGTGGACAGGATGC -3'

Sequencing Primer
(F):5'- TGGCATTCATCTCCCTGAGAAAAG -3'
(R):5'- CAGGATGCACAAAGGAATAGCTTATG -3'
Posted On2014-06-23