Incidental Mutation 'R1860:Olfr1272'
ID203769
Institutional Source Beutler Lab
Gene Symbol Olfr1272
Ensembl Gene ENSMUSG00000075061
Gene Nameolfactory receptor 1272
SynonymsGA_x6K02T2Q125-51636504-51635578, MOR227-3
MMRRC Submission 039883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1860 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90280263-90292841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90282158 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 139 (C139F)
Ref Sequence ENSEMBL: ENSMUSP00000150745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099750] [ENSMUST00000117141]
Predicted Effect probably damaging
Transcript: ENSMUST00000099750
AA Change: C139F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097339
Gene: ENSMUSG00000075061
AA Change: C139F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 7.5e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.5e-5 PFAM
Pfam:7tm_1 39 285 1.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117141
AA Change: C139F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0272 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,232 C587R probably damaging Het
Abca16 T A 7: 120,534,763 S1320T probably benign Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Acadsb T A 7: 131,444,229 probably null Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Adgre1 T C 17: 57,441,363 V521A probably benign Het
Adh5 G A 3: 138,453,778 V288I probably benign Het
Astn1 A C 1: 158,601,945 N753T probably damaging Het
Atad2 A T 15: 58,096,718 probably null Het
Best3 A G 10: 116,993,273 T153A probably damaging Het
Ccdc122 G A 14: 77,111,407 V226I probably damaging Het
Ccdc175 T C 12: 72,105,926 Q735R probably benign Het
Cd19 T A 7: 126,409,641 I499F probably damaging Het
Cftr T A 6: 18,268,289 L749H probably benign Het
Clec2h G T 6: 128,675,827 G186W probably damaging Het
Cpsf3 T A 12: 21,296,732 I202N probably damaging Het
Crebbp G T 16: 4,087,736 T1669N possibly damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cul4a G A 8: 13,123,565 R204Q probably damaging Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Derl2 A G 11: 71,018,343 F43S probably damaging Het
Dnah14 T A 1: 181,763,960 N3348K probably damaging Het
Dnhd1 T C 7: 105,704,205 V2855A probably benign Het
Dpysl4 G T 7: 139,090,299 C27F probably benign Het
Fam228b G A 12: 4,748,314 A163V probably damaging Het
Fscn1 T C 5: 142,970,063 probably null Het
Fzd5 C A 1: 64,734,994 R536L probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gpr176 T A 2: 118,373,178 N4Y probably damaging Het
Grin3a T C 4: 49,665,309 I1109V possibly damaging Het
H2afy A G 13: 56,083,204 L287P probably damaging Het
Hcar1 T A 5: 123,879,029 I200F probably damaging Het
Heatr4 G A 12: 83,979,728 Q252* probably null Het
Hps1 G A 19: 42,762,449 H371Y probably damaging Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Kdm1b G A 13: 47,049,190 A34T probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Ltn1 A T 16: 87,416,343 D443E probably benign Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mb A G 15: 77,017,584 Y104H probably damaging Het
Mrc1 C A 2: 14,328,579 P1357Q probably benign Het
Nfib C T 4: 82,323,680 V425M probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1262 G A 2: 90,003,146 V247I probably benign Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr473 A G 7: 107,934,390 Y290C probably damaging Het
Olfr527 G A 7: 140,336,219 R119H possibly damaging Het
Olfr654 T C 7: 104,587,905 S34P probably damaging Het
Olfr732 A T 14: 50,281,391 Y287* probably null Het
Olfr784 T C 10: 129,388,086 F151S probably damaging Het
Olfr916 A T 9: 38,658,365 V9E probably damaging Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Prkaca T C 8: 83,981,223 S46P probably benign Het
Prkcb T G 7: 122,568,201 V378G probably damaging Het
Ptprf A T 4: 118,223,932 L576Q probably damaging Het
Rapgef4 T C 2: 72,234,720 V687A probably benign Het
Rsad2 C T 12: 26,450,617 V224I probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scn1a C T 2: 66,317,982 S1073N probably damaging Het
Slc26a3 A G 12: 31,465,846 M582V probably benign Het
Tbc1d32 A T 10: 56,123,537 Y846* probably null Het
Tbk1 A T 10: 121,547,171 M719K probably benign Het
Timeless A G 10: 128,246,114 K536R probably benign Het
Tle6 G T 10: 81,594,329 Q330K probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Toe1 T C 4: 116,805,229 Y273C probably damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ubxn11 G A 4: 134,124,838 S32N probably damaging Het
Usp8 G A 2: 126,756,040 C961Y probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r124 G T 17: 18,049,497 W5L probably benign Het
Vmn2r71 A T 7: 85,615,574 D38V probably damaging Het
Vmn2r87 C T 10: 130,479,886 V104I probably benign Het
Vmn2r97 C T 17: 18,947,386 T634I probably benign Het
Vps50 T C 6: 3,520,279 probably null Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Zfp14 C T 7: 30,038,691 V290M probably damaging Het
Zfp317 G A 9: 19,641,984 A18T possibly damaging Het
Zfp354b A T 11: 50,923,542 N185K probably benign Het
Zscan21 T A 5: 138,126,630 D269E probably benign Het
Other mutations in Olfr1272
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Olfr1272 APN 2 90282081 missense possibly damaging 0.55
IGL01824:Olfr1272 APN 2 90281919 missense probably damaging 1.00
IGL01951:Olfr1272 APN 2 90282007 missense probably damaging 1.00
IGL02473:Olfr1272 APN 2 90281696 missense probably null 1.00
IGL02494:Olfr1272 APN 2 90281951 missense probably benign 0.35
IGL03410:Olfr1272 APN 2 90282213 missense probably damaging 1.00
R0350:Olfr1272 UTSW 2 90282582 unclassified probably null
R0363:Olfr1272 UTSW 2 90281856 missense probably damaging 1.00
R0401:Olfr1272 UTSW 2 90282404 missense probably damaging 1.00
R0666:Olfr1272 UTSW 2 90281868 missense probably damaging 0.96
R1861:Olfr1272 UTSW 2 90282158 missense probably damaging 1.00
R2374:Olfr1272 UTSW 2 90282451 missense possibly damaging 0.76
R4256:Olfr1272 UTSW 2 90282062 missense probably damaging 1.00
R4737:Olfr1272 UTSW 2 90282381 missense probably damaging 1.00
R4827:Olfr1272 UTSW 2 90282203 missense probably damaging 1.00
R5198:Olfr1272 UTSW 2 90296393 missense probably damaging 1.00
R5589:Olfr1272 UTSW 2 90281969 missense probably damaging 1.00
R6412:Olfr1272 UTSW 2 90281858 missense probably damaging 1.00
R7130:Olfr1272 UTSW 2 90281922 missense not run
Predicted Primers PCR Primer
(F):5'- CCACTGTTGGCCATCACAAC -3'
(R):5'- CCTGGTGGAGATCTGTTACTC -3'

Sequencing Primer
(F):5'- TGTTGGCCATCACAACAACAC -3'
(R):5'- GGAGATCTGTTACTCCTCTACAATTG -3'
Posted On2014-06-23