Incidental Mutation 'R1860:Lef1'
ID203774
Institutional Source Beutler Lab
Gene Symbol Lef1
Ensembl Gene ENSMUSG00000027985
Gene Namelymphoid enhancer binding factor 1
Synonymslymphoid enhancer factor 1, Lef-1
MMRRC Submission 039883-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1860 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location131110471-131224356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131111641 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 57 (N57S)
Ref Sequence ENSEMBL: ENSMUSP00000101948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029611] [ENSMUST00000066849] [ENSMUST00000098611] [ENSMUST00000106341]
Predicted Effect probably damaging
Transcript: ENSMUST00000029611
AA Change: N57S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029611
Gene: ENSMUSG00000027985
AA Change: N57S

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 5e-88 PFAM
low complexity region 245 259 N/A INTRINSIC
HMG 296 366 7.68e-23 SMART
low complexity region 372 380 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066849
AA Change: N57S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067808
Gene: ENSMUSG00000027985
AA Change: N57S

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 1e-75 PFAM
low complexity region 217 231 N/A INTRINSIC
HMG 268 338 7.68e-23 SMART
low complexity region 344 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098611
SMART Domains Protein: ENSMUSP00000096211
Gene: ENSMUSG00000027985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 145 2.8e-54 PFAM
low complexity region 179 193 N/A INTRINSIC
HMG 230 300 7.68e-23 SMART
low complexity region 306 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106341
AA Change: N57S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101948
Gene: ENSMUSG00000027985
AA Change: N57S

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 1.3e-75 PFAM
low complexity region 217 231 N/A INTRINSIC
HMG 268 338 7.68e-23 SMART
low complexity region 344 352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200166
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. This transcription factor is involved in the Wnt signaling pathway, and it may function in hair cell differentiation and follicle morphogenesis. Mutations in this gene have been found in somatic sebaceous tumors. This gene has also been linked to other cancers, including androgen-independent prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele are small and die postnatally showing lack of teeth, mammary and uterine glands, whiskers, body hair, dermal-associated fat, and a dentate gyrus, as well as defects in hippocampus morphology, hair follicle development, retinal vasculature, and vascular regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,232 C587R probably damaging Het
Abca16 T A 7: 120,534,763 S1320T probably benign Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Acadsb T A 7: 131,444,229 probably null Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Adgre1 T C 17: 57,441,363 V521A probably benign Het
Adh5 G A 3: 138,453,778 V288I probably benign Het
Astn1 A C 1: 158,601,945 N753T probably damaging Het
Atad2 A T 15: 58,096,718 probably null Het
Best3 A G 10: 116,993,273 T153A probably damaging Het
Ccdc122 G A 14: 77,111,407 V226I probably damaging Het
Ccdc175 T C 12: 72,105,926 Q735R probably benign Het
Cd19 T A 7: 126,409,641 I499F probably damaging Het
Cftr T A 6: 18,268,289 L749H probably benign Het
Clec2h G T 6: 128,675,827 G186W probably damaging Het
Cpsf3 T A 12: 21,296,732 I202N probably damaging Het
Crebbp G T 16: 4,087,736 T1669N possibly damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cul4a G A 8: 13,123,565 R204Q probably damaging Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Derl2 A G 11: 71,018,343 F43S probably damaging Het
Dnah14 T A 1: 181,763,960 N3348K probably damaging Het
Dnhd1 T C 7: 105,704,205 V2855A probably benign Het
Dpysl4 G T 7: 139,090,299 C27F probably benign Het
Fam228b G A 12: 4,748,314 A163V probably damaging Het
Fscn1 T C 5: 142,970,063 probably null Het
Fzd5 C A 1: 64,734,994 R536L probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gpr176 T A 2: 118,373,178 N4Y probably damaging Het
Grin3a T C 4: 49,665,309 I1109V possibly damaging Het
H2afy A G 13: 56,083,204 L287P probably damaging Het
Hcar1 T A 5: 123,879,029 I200F probably damaging Het
Heatr4 G A 12: 83,979,728 Q252* probably null Het
Hps1 G A 19: 42,762,449 H371Y probably damaging Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Kdm1b G A 13: 47,049,190 A34T probably benign Het
Ltn1 A T 16: 87,416,343 D443E probably benign Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mb A G 15: 77,017,584 Y104H probably damaging Het
Mrc1 C A 2: 14,328,579 P1357Q probably benign Het
Nfib C T 4: 82,323,680 V425M probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1262 G A 2: 90,003,146 V247I probably benign Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr473 A G 7: 107,934,390 Y290C probably damaging Het
Olfr527 G A 7: 140,336,219 R119H possibly damaging Het
Olfr654 T C 7: 104,587,905 S34P probably damaging Het
Olfr732 A T 14: 50,281,391 Y287* probably null Het
Olfr784 T C 10: 129,388,086 F151S probably damaging Het
Olfr916 A T 9: 38,658,365 V9E probably damaging Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Prkaca T C 8: 83,981,223 S46P probably benign Het
Prkcb T G 7: 122,568,201 V378G probably damaging Het
Ptprf A T 4: 118,223,932 L576Q probably damaging Het
Rapgef4 T C 2: 72,234,720 V687A probably benign Het
Rsad2 C T 12: 26,450,617 V224I probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scn1a C T 2: 66,317,982 S1073N probably damaging Het
Slc26a3 A G 12: 31,465,846 M582V probably benign Het
Tbc1d32 A T 10: 56,123,537 Y846* probably null Het
Tbk1 A T 10: 121,547,171 M719K probably benign Het
Timeless A G 10: 128,246,114 K536R probably benign Het
Tle6 G T 10: 81,594,329 Q330K probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Toe1 T C 4: 116,805,229 Y273C probably damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ubxn11 G A 4: 134,124,838 S32N probably damaging Het
Usp8 G A 2: 126,756,040 C961Y probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r124 G T 17: 18,049,497 W5L probably benign Het
Vmn2r71 A T 7: 85,615,574 D38V probably damaging Het
Vmn2r87 C T 10: 130,479,886 V104I probably benign Het
Vmn2r97 C T 17: 18,947,386 T634I probably benign Het
Vps50 T C 6: 3,520,279 probably null Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Zfp14 C T 7: 30,038,691 V290M probably damaging Het
Zfp317 G A 9: 19,641,984 A18T possibly damaging Het
Zfp354b A T 11: 50,923,542 N185K probably benign Het
Zscan21 T A 5: 138,126,630 D269E probably benign Het
Other mutations in Lef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Lef1 APN 3 131113850 splice site probably benign
IGL00515:Lef1 APN 3 131204277 missense probably damaging 1.00
IGL00780:Lef1 APN 3 131193130 missense possibly damaging 0.69
IGL02057:Lef1 APN 3 131200402 nonsense probably null
IGL02556:Lef1 APN 3 131194793 splice site probably null
IGL02804:Lef1 APN 3 131194689 missense probably damaging 1.00
IGL03143:Lef1 APN 3 131200316 nonsense probably null
IGL03169:Lef1 APN 3 131194663 missense probably damaging 1.00
R0470:Lef1 UTSW 3 131112826 intron probably benign
R1354:Lef1 UTSW 3 131194668 missense probably damaging 1.00
R1677:Lef1 UTSW 3 131200289 splice site probably benign
R2013:Lef1 UTSW 3 131111587 missense probably damaging 0.98
R2015:Lef1 UTSW 3 131111587 missense probably damaging 0.98
R3440:Lef1 UTSW 3 131184758 missense probably damaging 1.00
R3736:Lef1 UTSW 3 131191066 missense possibly damaging 0.51
R3918:Lef1 UTSW 3 131111641 missense probably damaging 0.99
R4052:Lef1 UTSW 3 131194689 missense probably damaging 1.00
R4346:Lef1 UTSW 3 131194708 missense probably damaging 1.00
R4608:Lef1 UTSW 3 131184733 missense probably benign 0.00
R4764:Lef1 UTSW 3 131184733 missense probably benign 0.00
R4786:Lef1 UTSW 3 131111524 missense probably damaging 0.99
R5298:Lef1 UTSW 3 131194667 missense possibly damaging 0.80
R5394:Lef1 UTSW 3 131194659 missense probably damaging 1.00
R6827:Lef1 UTSW 3 131200404 critical splice donor site probably null
R6893:Lef1 UTSW 3 131115500 missense possibly damaging 0.77
R6974:Lef1 UTSW 3 131111574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAAGTGGGAAAGCGCGG -3'
(R):5'- ATGGACTAGGGGCCGTTATTCC -3'

Sequencing Primer
(F):5'- AGATTACACAGCCGCCGG -3'
(R):5'- GGCCGTTATTCCCCACCCAG -3'
Posted On2014-06-23