Incidental Mutation 'R1860:Grin3a'
ID203776
Institutional Source Beutler Lab
Gene Symbol Grin3a
Ensembl Gene ENSMUSG00000039579
Gene Nameglutamate receptor ionotropic, NMDA3A
SynonymsNR3A, A830097C19Rik, NMDAR-L
MMRRC Submission 039883-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1860 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location49661611-49845744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49665309 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1109 (I1109V)
Ref Sequence ENSEMBL: ENSMUSP00000091381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076674] [ENSMUST00000093859]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076674
AA Change: I1089V

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075970
Gene: ENSMUSG00000039579
AA Change: I1089V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1063 1105 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093859
AA Change: I1109V

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091381
Gene: ENSMUSG00000039579
AA Change: I1109V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1083 1125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptors, which belong to the superfamily of glutamate-regulated ion channels, and function in physiological and pathological processes in the central nervous system. This subunit shows greater than 90% identity to the corresponding subunit in rat. Studies in the knockout mouse deficient in this subunit suggest that this gene may be involved in the development of synaptic elements by modulating NMDA receptor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased current densities in some cerebrocortical neurons of the brain, increased levels of prepulse inhibition, and altered dendritic spine morphology. Otherwise, they display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,232 C587R probably damaging Het
Abca16 T A 7: 120,534,763 S1320T probably benign Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Acadsb T A 7: 131,444,229 probably null Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Adgre1 T C 17: 57,441,363 V521A probably benign Het
Adh5 G A 3: 138,453,778 V288I probably benign Het
Astn1 A C 1: 158,601,945 N753T probably damaging Het
Atad2 A T 15: 58,096,718 probably null Het
Best3 A G 10: 116,993,273 T153A probably damaging Het
Ccdc122 G A 14: 77,111,407 V226I probably damaging Het
Ccdc175 T C 12: 72,105,926 Q735R probably benign Het
Cd19 T A 7: 126,409,641 I499F probably damaging Het
Cftr T A 6: 18,268,289 L749H probably benign Het
Clec2h G T 6: 128,675,827 G186W probably damaging Het
Cpsf3 T A 12: 21,296,732 I202N probably damaging Het
Crebbp G T 16: 4,087,736 T1669N possibly damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cul4a G A 8: 13,123,565 R204Q probably damaging Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Derl2 A G 11: 71,018,343 F43S probably damaging Het
Dnah14 T A 1: 181,763,960 N3348K probably damaging Het
Dnhd1 T C 7: 105,704,205 V2855A probably benign Het
Dpysl4 G T 7: 139,090,299 C27F probably benign Het
Fam228b G A 12: 4,748,314 A163V probably damaging Het
Fscn1 T C 5: 142,970,063 probably null Het
Fzd5 C A 1: 64,734,994 R536L probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gpr176 T A 2: 118,373,178 N4Y probably damaging Het
H2afy A G 13: 56,083,204 L287P probably damaging Het
Hcar1 T A 5: 123,879,029 I200F probably damaging Het
Heatr4 G A 12: 83,979,728 Q252* probably null Het
Hps1 G A 19: 42,762,449 H371Y probably damaging Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Kdm1b G A 13: 47,049,190 A34T probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Ltn1 A T 16: 87,416,343 D443E probably benign Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mb A G 15: 77,017,584 Y104H probably damaging Het
Mrc1 C A 2: 14,328,579 P1357Q probably benign Het
Nfib C T 4: 82,323,680 V425M probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1262 G A 2: 90,003,146 V247I probably benign Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr473 A G 7: 107,934,390 Y290C probably damaging Het
Olfr527 G A 7: 140,336,219 R119H possibly damaging Het
Olfr654 T C 7: 104,587,905 S34P probably damaging Het
Olfr732 A T 14: 50,281,391 Y287* probably null Het
Olfr784 T C 10: 129,388,086 F151S probably damaging Het
Olfr916 A T 9: 38,658,365 V9E probably damaging Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Prkaca T C 8: 83,981,223 S46P probably benign Het
Prkcb T G 7: 122,568,201 V378G probably damaging Het
Ptprf A T 4: 118,223,932 L576Q probably damaging Het
Rapgef4 T C 2: 72,234,720 V687A probably benign Het
Rsad2 C T 12: 26,450,617 V224I probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scn1a C T 2: 66,317,982 S1073N probably damaging Het
Slc26a3 A G 12: 31,465,846 M582V probably benign Het
Tbc1d32 A T 10: 56,123,537 Y846* probably null Het
Tbk1 A T 10: 121,547,171 M719K probably benign Het
Timeless A G 10: 128,246,114 K536R probably benign Het
Tle6 G T 10: 81,594,329 Q330K probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Toe1 T C 4: 116,805,229 Y273C probably damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ubxn11 G A 4: 134,124,838 S32N probably damaging Het
Usp8 G A 2: 126,756,040 C961Y probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r124 G T 17: 18,049,497 W5L probably benign Het
Vmn2r71 A T 7: 85,615,574 D38V probably damaging Het
Vmn2r87 C T 10: 130,479,886 V104I probably benign Het
Vmn2r97 C T 17: 18,947,386 T634I probably benign Het
Vps50 T C 6: 3,520,279 probably null Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Zfp14 C T 7: 30,038,691 V290M probably damaging Het
Zfp317 G A 9: 19,641,984 A18T possibly damaging Het
Zfp354b A T 11: 50,923,542 N185K probably benign Het
Zscan21 T A 5: 138,126,630 D269E probably benign Het
Other mutations in Grin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Grin3a APN 4 49770589 missense probably damaging 1.00
IGL01541:Grin3a APN 4 49792533 missense probably damaging 0.98
IGL01886:Grin3a APN 4 49702814 missense probably damaging 1.00
IGL02133:Grin3a APN 4 49792946 nonsense probably null
IGL02367:Grin3a APN 4 49702805 missense probably damaging 1.00
IGL02481:Grin3a APN 4 49702868 missense probably damaging 1.00
IGL02830:Grin3a APN 4 49702787 missense possibly damaging 0.94
IGL02945:Grin3a APN 4 49792971 missense possibly damaging 0.86
IGL03174:Grin3a APN 4 49771107 missense probably damaging 1.00
R0266:Grin3a UTSW 4 49665501 nonsense probably null
R0597:Grin3a UTSW 4 49665351 missense probably damaging 1.00
R0849:Grin3a UTSW 4 49665501 nonsense probably null
R1448:Grin3a UTSW 4 49702804 missense probably damaging 1.00
R1640:Grin3a UTSW 4 49844721 missense probably benign
R1751:Grin3a UTSW 4 49844423 missense probably damaging 1.00
R1767:Grin3a UTSW 4 49844423 missense probably damaging 1.00
R1858:Grin3a UTSW 4 49792437 missense probably benign 0.01
R1924:Grin3a UTSW 4 49844988 missense possibly damaging 0.95
R2035:Grin3a UTSW 4 49771336 missense probably damaging 1.00
R2108:Grin3a UTSW 4 49665510 missense possibly damaging 0.91
R2307:Grin3a UTSW 4 49793033 critical splice acceptor site probably null
R3082:Grin3a UTSW 4 49665243 missense probably benign 0.00
R3083:Grin3a UTSW 4 49665243 missense probably benign 0.00
R3430:Grin3a UTSW 4 49792534 missense probably benign 0.01
R3695:Grin3a UTSW 4 49792704 missense possibly damaging 0.81
R3932:Grin3a UTSW 4 49672472 critical splice donor site probably null
R4559:Grin3a UTSW 4 49844555 missense probably damaging 1.00
R4972:Grin3a UTSW 4 49770484 missense probably damaging 1.00
R4982:Grin3a UTSW 4 49665512 missense probably benign 0.03
R5385:Grin3a UTSW 4 49719313 missense probably damaging 1.00
R5423:Grin3a UTSW 4 49770376 intron probably benign
R5478:Grin3a UTSW 4 49792481 missense probably benign 0.00
R5634:Grin3a UTSW 4 49792843 missense probably damaging 1.00
R5790:Grin3a UTSW 4 49792717 missense probably damaging 1.00
R5976:Grin3a UTSW 4 49792602 missense probably damaging 1.00
R6271:Grin3a UTSW 4 49792516 missense probably benign 0.00
R6451:Grin3a UTSW 4 49844969 missense probably damaging 1.00
R6538:Grin3a UTSW 4 49770856 missense probably damaging 1.00
R6629:Grin3a UTSW 4 49844991 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACACTTCATTTGCCAGAC -3'
(R):5'- TTCCAATCTGAGTCACGACAAC -3'

Sequencing Primer
(F):5'- GACCCCACACCTTTGTCAATAG -3'
(R):5'- CTTTAATGATGAGGAAGGACAAAACC -3'
Posted On2014-06-23