Incidental Mutation 'R1860:Ptprf'
ID203779
Institutional Source Beutler Lab
Gene Symbol Ptprf
Ensembl Gene ENSMUSG00000033295
Gene Nameprotein tyrosine phosphatase, receptor type, F
SynonymsRPTP-LAR, LAR
MMRRC Submission 039883-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.690) question?
Stock #R1860 (G1)
Quality Score201
Status Not validated
Chromosome4
Chromosomal Location118208213-118291405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118223932 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 576 (L576Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049074]
Predicted Effect probably benign
Transcript: ENSMUST00000049074
AA Change: L1154Q

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: L1154Q

DomainStartEndE-ValueType
IGc2 45 114 2.64e-12 SMART
IGc2 147 214 1.48e-15 SMART
IG 238 316 1.06e-11 SMART
FN3 319 398 6.9e-14 SMART
FN3 414 497 5.73e-11 SMART
FN3 512 591 4.06e-11 SMART
FN3 606 693 8.69e-11 SMART
FN3 709 797 8.83e-12 SMART
FN3 812 892 3.2e-9 SMART
FN3 907 988 2.53e-12 SMART
FN3 1003 1079 3.48e-1 SMART
coiled coil region 1146 1175 N/A INTRINSIC
transmembrane domain 1253 1275 N/A INTRINSIC
PTPc 1342 1600 1.12e-138 SMART
PTPc 1629 1891 3.4e-129 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124758
AA Change: L576Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295
AA Change: L576Q

DomainStartEndE-ValueType
FN3 37 116 4.06e-11 SMART
FN3 132 220 8.83e-12 SMART
FN3 235 315 3.2e-9 SMART
FN3 330 411 2.53e-12 SMART
FN3 426 502 3.48e-1 SMART
coiled coil region 568 597 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
PTPc 776 1034 1.12e-138 SMART
PTPc 1063 1325 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143348
Predicted Effect possibly damaging
Transcript: ENSMUST00000150096
AA Change: L535Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: L535Q

DomainStartEndE-ValueType
FN3 14 66 2.7e1 SMART
FN3 82 165 5.73e-11 SMART
FN3 180 259 4.06e-11 SMART
FN3 275 372 6.69e-12 SMART
FN3 385 461 2.83e-1 SMART
coiled coil region 527 556 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
PTPc 735 993 1.12e-138 SMART
PTPc 1022 1284 3.4e-129 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,232 C587R probably damaging Het
Abca16 T A 7: 120,534,763 S1320T probably benign Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Acadsb T A 7: 131,444,229 probably null Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Adgre1 T C 17: 57,441,363 V521A probably benign Het
Adh5 G A 3: 138,453,778 V288I probably benign Het
Astn1 A C 1: 158,601,945 N753T probably damaging Het
Atad2 A T 15: 58,096,718 probably null Het
Best3 A G 10: 116,993,273 T153A probably damaging Het
Ccdc122 G A 14: 77,111,407 V226I probably damaging Het
Ccdc175 T C 12: 72,105,926 Q735R probably benign Het
Cd19 T A 7: 126,409,641 I499F probably damaging Het
Cftr T A 6: 18,268,289 L749H probably benign Het
Clec2h G T 6: 128,675,827 G186W probably damaging Het
Cpsf3 T A 12: 21,296,732 I202N probably damaging Het
Crebbp G T 16: 4,087,736 T1669N possibly damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cul4a G A 8: 13,123,565 R204Q probably damaging Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Derl2 A G 11: 71,018,343 F43S probably damaging Het
Dnah14 T A 1: 181,763,960 N3348K probably damaging Het
Dnhd1 T C 7: 105,704,205 V2855A probably benign Het
Dpysl4 G T 7: 139,090,299 C27F probably benign Het
Fam228b G A 12: 4,748,314 A163V probably damaging Het
Fscn1 T C 5: 142,970,063 probably null Het
Fzd5 C A 1: 64,734,994 R536L probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gpr176 T A 2: 118,373,178 N4Y probably damaging Het
Grin3a T C 4: 49,665,309 I1109V possibly damaging Het
H2afy A G 13: 56,083,204 L287P probably damaging Het
Hcar1 T A 5: 123,879,029 I200F probably damaging Het
Heatr4 G A 12: 83,979,728 Q252* probably null Het
Hps1 G A 19: 42,762,449 H371Y probably damaging Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Kdm1b G A 13: 47,049,190 A34T probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Ltn1 A T 16: 87,416,343 D443E probably benign Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mb A G 15: 77,017,584 Y104H probably damaging Het
Mrc1 C A 2: 14,328,579 P1357Q probably benign Het
Nfib C T 4: 82,323,680 V425M probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1262 G A 2: 90,003,146 V247I probably benign Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr473 A G 7: 107,934,390 Y290C probably damaging Het
Olfr527 G A 7: 140,336,219 R119H possibly damaging Het
Olfr654 T C 7: 104,587,905 S34P probably damaging Het
Olfr732 A T 14: 50,281,391 Y287* probably null Het
Olfr784 T C 10: 129,388,086 F151S probably damaging Het
Olfr916 A T 9: 38,658,365 V9E probably damaging Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Prkaca T C 8: 83,981,223 S46P probably benign Het
Prkcb T G 7: 122,568,201 V378G probably damaging Het
Rapgef4 T C 2: 72,234,720 V687A probably benign Het
Rsad2 C T 12: 26,450,617 V224I probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scn1a C T 2: 66,317,982 S1073N probably damaging Het
Slc26a3 A G 12: 31,465,846 M582V probably benign Het
Tbc1d32 A T 10: 56,123,537 Y846* probably null Het
Tbk1 A T 10: 121,547,171 M719K probably benign Het
Timeless A G 10: 128,246,114 K536R probably benign Het
Tle6 G T 10: 81,594,329 Q330K probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Toe1 T C 4: 116,805,229 Y273C probably damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ubxn11 G A 4: 134,124,838 S32N probably damaging Het
Usp8 G A 2: 126,756,040 C961Y probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r124 G T 17: 18,049,497 W5L probably benign Het
Vmn2r71 A T 7: 85,615,574 D38V probably damaging Het
Vmn2r87 C T 10: 130,479,886 V104I probably benign Het
Vmn2r97 C T 17: 18,947,386 T634I probably benign Het
Vps50 T C 6: 3,520,279 probably null Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Zfp14 C T 7: 30,038,691 V290M probably damaging Het
Zfp317 G A 9: 19,641,984 A18T possibly damaging Het
Zfp354b A T 11: 50,923,542 N185K probably benign Het
Zscan21 T A 5: 138,126,630 D269E probably benign Het
Other mutations in Ptprf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ptprf APN 4 118223220 splice site probably benign
IGL01337:Ptprf APN 4 118236291 missense probably damaging 1.00
IGL01482:Ptprf APN 4 118212454 missense probably damaging 1.00
IGL01743:Ptprf APN 4 118248898 critical splice donor site probably null
IGL01987:Ptprf APN 4 118277370 missense probably benign
IGL02189:Ptprf APN 4 118213642 splice site probably benign
IGL03067:Ptprf APN 4 118210713 missense possibly damaging 0.67
R0382:Ptprf UTSW 4 118223394 splice site probably benign
R0788:Ptprf UTSW 4 118226466 missense probably damaging 0.97
R1164:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R1478:Ptprf UTSW 4 118212105 nonsense probably null
R1483:Ptprf UTSW 4 118235964 missense possibly damaging 0.81
R1611:Ptprf UTSW 4 118236233 missense probably benign 0.34
R1721:Ptprf UTSW 4 118224899 missense possibly damaging 0.56
R1817:Ptprf UTSW 4 118223265 missense probably benign 0.02
R1818:Ptprf UTSW 4 118209871 missense probably damaging 1.00
R2208:Ptprf UTSW 4 118269172 splice site probably benign
R2406:Ptprf UTSW 4 118269304 missense possibly damaging 0.62
R2912:Ptprf UTSW 4 118248980 missense probably damaging 0.98
R3111:Ptprf UTSW 4 118211432 missense probably damaging 1.00
R3498:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3499:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3615:Ptprf UTSW 4 118237883 missense probably benign 0.04
R3616:Ptprf UTSW 4 118237883 missense probably benign 0.04
R4038:Ptprf UTSW 4 118257608 missense probably damaging 1.00
R4243:Ptprf UTSW 4 118226452 critical splice donor site probably null
R4260:Ptprf UTSW 4 118226083 missense possibly damaging 0.64
R4693:Ptprf UTSW 4 118211022 missense probably benign 0.16
R4726:Ptprf UTSW 4 118212217 missense possibly damaging 0.86
R4746:Ptprf UTSW 4 118225039 missense possibly damaging 0.83
R4802:Ptprf UTSW 4 118210329 intron probably benign
R4857:Ptprf UTSW 4 118217197 splice site probably benign
R5071:Ptprf UTSW 4 118211999 missense probably damaging 1.00
R5221:Ptprf UTSW 4 118225108 missense probably benign 0.00
R5327:Ptprf UTSW 4 118236389 missense probably damaging 1.00
R5336:Ptprf UTSW 4 118235634 missense probably damaging 1.00
R5356:Ptprf UTSW 4 118226338 missense probably benign 0.00
R5373:Ptprf UTSW 4 118226041 missense possibly damaging 0.93
R5555:Ptprf UTSW 4 118224924 missense probably damaging 1.00
R5693:Ptprf UTSW 4 118236177 nonsense probably null
R5860:Ptprf UTSW 4 118211289 intron probably benign
R5869:Ptprf UTSW 4 118210382 missense probably damaging 1.00
R5890:Ptprf UTSW 4 118224735 missense probably benign
R5932:Ptprf UTSW 4 118211767 missense probably benign 0.10
R6028:Ptprf UTSW 4 118213629 missense probably benign 0.01
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6088:Ptprf UTSW 4 118210755 missense possibly damaging 0.68
R6089:Ptprf UTSW 4 118211084 missense probably damaging 0.99
R6108:Ptprf UTSW 4 118223256 missense probably benign 0.01
R6320:Ptprf UTSW 4 118212814 missense probably benign
R6741:Ptprf UTSW 4 118223368 missense probably benign 0.00
R6744:Ptprf UTSW 4 118236365 missense probably benign 0.00
R6750:Ptprf UTSW 4 118231731 missense probably benign 0.03
R6906:Ptprf UTSW 4 118269277 missense possibly damaging 0.95
R7021:Ptprf UTSW 4 118223904 missense probably benign 0.00
R7153:Ptprf UTSW 4 118231543 missense not run
X0067:Ptprf UTSW 4 118236026 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AACTCAGATCCGGAGACAGG -3'
(R):5'- ACAGCTCATGTCAAAACTGCTTTC -3'

Sequencing Primer
(F):5'- ACAGGGGCCGGTTGTAG -3'
(R):5'- CCTTCCTTATAGGCTACAAGGAGG -3'
Posted On2014-06-23