Incidental Mutation 'R1860:Ubxn11'
ID203781
Institutional Source Beutler Lab
Gene Symbol Ubxn11
Ensembl Gene ENSMUSG00000012126
Gene NameUBX domain protein 11
SynonymsSoci, 4930506L07Rik, Ubxd5
MMRRC Submission 039883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R1860 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134102570-134127593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 134124838 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 32 (S32N)
Ref Sequence ENSEMBL: ENSMUSP00000122892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030651] [ENSMUST00000070246] [ENSMUST00000074690] [ENSMUST00000105879] [ENSMUST00000151113]
Predicted Effect probably benign
Transcript: ENSMUST00000030651
SMART Domains Protein: ENSMUSP00000030651
Gene: ENSMUSG00000028843

DomainStartEndE-ValueType
Pfam:SH3BGR 2 93 6.3e-40 PFAM
Pfam:Glutaredoxin 22 70 9.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070246
AA Change: S165N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064030
Gene: ENSMUSG00000012126
AA Change: S165N

DomainStartEndE-ValueType
Pfam:SEP 114 185 1.5e-20 PFAM
UBX 268 350 2.3e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074690
AA Change: S283N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074255
Gene: ENSMUSG00000012126
AA Change: S283N

DomainStartEndE-ValueType
coiled coil region 69 147 N/A INTRINSIC
Pfam:SEP 232 303 7.9e-20 PFAM
UBX 386 468 2.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142442
Predicted Effect probably damaging
Transcript: ENSMUST00000151113
AA Change: S32N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122892
Gene: ENSMUSG00000012126
AA Change: S32N

DomainStartEndE-ValueType
Blast:SEP 15 64 2e-13 BLAST
SCOP:d1i42a_ 129 173 4e-5 SMART
Blast:UBX 135 174 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156323
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a divergent C-terminal UBX domain. The homologous protein in the rat interacts with members of the Rnd subfamily of Rho GTPases at the cell periphery through its C-terminal region. It also interacts with several heterotrimeric G proteins through their G-alpha subunits and promotes Rho GTPase activation. It is proposed to serve a bidirectional role in the promotion and inhibition of Rho activity through upstream signaling pathways. The 3' coding sequence of this gene contains a polymoprhic region of 24 nt tandem repeats. Several transcripts containing between 1.5 and five repeat units have been reported. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,232 C587R probably damaging Het
Abca16 T A 7: 120,534,763 S1320T probably benign Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Acadsb T A 7: 131,444,229 probably null Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Adgre1 T C 17: 57,441,363 V521A probably benign Het
Adh5 G A 3: 138,453,778 V288I probably benign Het
Astn1 A C 1: 158,601,945 N753T probably damaging Het
Atad2 A T 15: 58,096,718 probably null Het
Best3 A G 10: 116,993,273 T153A probably damaging Het
Ccdc122 G A 14: 77,111,407 V226I probably damaging Het
Ccdc175 T C 12: 72,105,926 Q735R probably benign Het
Cd19 T A 7: 126,409,641 I499F probably damaging Het
Cftr T A 6: 18,268,289 L749H probably benign Het
Clec2h G T 6: 128,675,827 G186W probably damaging Het
Cpsf3 T A 12: 21,296,732 I202N probably damaging Het
Crebbp G T 16: 4,087,736 T1669N possibly damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cul4a G A 8: 13,123,565 R204Q probably damaging Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Derl2 A G 11: 71,018,343 F43S probably damaging Het
Dnah14 T A 1: 181,763,960 N3348K probably damaging Het
Dnhd1 T C 7: 105,704,205 V2855A probably benign Het
Dpysl4 G T 7: 139,090,299 C27F probably benign Het
Fam228b G A 12: 4,748,314 A163V probably damaging Het
Fscn1 T C 5: 142,970,063 probably null Het
Fzd5 C A 1: 64,734,994 R536L probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gpr176 T A 2: 118,373,178 N4Y probably damaging Het
Grin3a T C 4: 49,665,309 I1109V possibly damaging Het
H2afy A G 13: 56,083,204 L287P probably damaging Het
Hcar1 T A 5: 123,879,029 I200F probably damaging Het
Heatr4 G A 12: 83,979,728 Q252* probably null Het
Hps1 G A 19: 42,762,449 H371Y probably damaging Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Kdm1b G A 13: 47,049,190 A34T probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Ltn1 A T 16: 87,416,343 D443E probably benign Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mb A G 15: 77,017,584 Y104H probably damaging Het
Mrc1 C A 2: 14,328,579 P1357Q probably benign Het
Nfib C T 4: 82,323,680 V425M probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1262 G A 2: 90,003,146 V247I probably benign Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr473 A G 7: 107,934,390 Y290C probably damaging Het
Olfr527 G A 7: 140,336,219 R119H possibly damaging Het
Olfr654 T C 7: 104,587,905 S34P probably damaging Het
Olfr732 A T 14: 50,281,391 Y287* probably null Het
Olfr784 T C 10: 129,388,086 F151S probably damaging Het
Olfr916 A T 9: 38,658,365 V9E probably damaging Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Prkaca T C 8: 83,981,223 S46P probably benign Het
Prkcb T G 7: 122,568,201 V378G probably damaging Het
Ptprf A T 4: 118,223,932 L576Q probably damaging Het
Rapgef4 T C 2: 72,234,720 V687A probably benign Het
Rsad2 C T 12: 26,450,617 V224I probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scn1a C T 2: 66,317,982 S1073N probably damaging Het
Slc26a3 A G 12: 31,465,846 M582V probably benign Het
Tbc1d32 A T 10: 56,123,537 Y846* probably null Het
Tbk1 A T 10: 121,547,171 M719K probably benign Het
Timeless A G 10: 128,246,114 K536R probably benign Het
Tle6 G T 10: 81,594,329 Q330K probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Toe1 T C 4: 116,805,229 Y273C probably damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Usp8 G A 2: 126,756,040 C961Y probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r124 G T 17: 18,049,497 W5L probably benign Het
Vmn2r71 A T 7: 85,615,574 D38V probably damaging Het
Vmn2r87 C T 10: 130,479,886 V104I probably benign Het
Vmn2r97 C T 17: 18,947,386 T634I probably benign Het
Vps50 T C 6: 3,520,279 probably null Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Zfp14 C T 7: 30,038,691 V290M probably damaging Het
Zfp317 G A 9: 19,641,984 A18T possibly damaging Het
Zfp354b A T 11: 50,923,542 N185K probably benign Het
Zscan21 T A 5: 138,126,630 D269E probably benign Het
Other mutations in Ubxn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02547:Ubxn11 APN 4 134109584 missense possibly damaging 0.82
IGL02559:Ubxn11 APN 4 134124943 missense probably damaging 0.98
R0015:Ubxn11 UTSW 4 134116025 splice site probably null
R0586:Ubxn11 UTSW 4 134109652 missense possibly damaging 0.49
R1449:Ubxn11 UTSW 4 134124892 missense probably damaging 1.00
R1513:Ubxn11 UTSW 4 134124141 critical splice donor site probably null
R3776:Ubxn11 UTSW 4 134108294 missense probably damaging 1.00
R4395:Ubxn11 UTSW 4 134116120 missense possibly damaging 0.53
R4840:Ubxn11 UTSW 4 134109608 missense probably damaging 1.00
R5387:Ubxn11 UTSW 4 134123426 missense probably damaging 1.00
R5460:Ubxn11 UTSW 4 134125085 missense probably damaging 1.00
R5560:Ubxn11 UTSW 4 134126624 missense probably damaging 1.00
R6611:Ubxn11 UTSW 4 134123599 missense probably damaging 1.00
R6901:Ubxn11 UTSW 4 134126264 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGGTCTTCAGTACTATGCC -3'
(R):5'- TTGGCCCAGGAGGAACTGTAAG -3'

Sequencing Primer
(F):5'- CAGTACTATGCCTTCAGCTAGTATG -3'
(R):5'- CCCAGGAGGAACTGTAAGTGCTG -3'
Posted On2014-06-23