Incidental Mutation 'R1860:Fscn1'
ID203785
Institutional Source Beutler Lab
Gene Symbol Fscn1
Ensembl Gene ENSMUSG00000029581
Gene Namefascin actin-bundling protein 1
SynonymsFan1, fascin-1
MMRRC Submission 039883-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R1860 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location142960343-142973185 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 142970063 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031565] [ENSMUST00000198017]
Predicted Effect probably null
Transcript: ENSMUST00000031565
SMART Domains Protein: ENSMUSP00000031565
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 20 134 1.9e-37 PFAM
Pfam:Fascin 142 256 4.1e-30 PFAM
Pfam:Fascin 268 378 1.3e-36 PFAM
Pfam:Fascin 391 493 9.4e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129306
SMART Domains Protein: ENSMUSP00000122862
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 16 126 1.1e-37 PFAM
Pfam:Fascin 139 241 8.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137552
SMART Domains Protein: ENSMUSP00000119590
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 1 100 1.6e-33 PFAM
Pfam:Fascin 113 167 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139131
SMART Domains Protein: ENSMUSP00000115116
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 1 100 1.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150622
SMART Domains Protein: ENSMUSP00000123347
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 1 100 3.4e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198017
SMART Domains Protein: ENSMUSP00000142509
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 20 74 2.3e-12 PFAM
Pfam:Fascin 107 217 7.3e-34 PFAM
Pfam:Fascin 230 332 1.5e-23 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired migration of mature dendritic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,232 C587R probably damaging Het
Abca16 T A 7: 120,534,763 S1320T probably benign Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Acadsb T A 7: 131,444,229 probably null Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Adgre1 T C 17: 57,441,363 V521A probably benign Het
Adh5 G A 3: 138,453,778 V288I probably benign Het
Astn1 A C 1: 158,601,945 N753T probably damaging Het
Atad2 A T 15: 58,096,718 probably null Het
Best3 A G 10: 116,993,273 T153A probably damaging Het
Ccdc122 G A 14: 77,111,407 V226I probably damaging Het
Ccdc175 T C 12: 72,105,926 Q735R probably benign Het
Cd19 T A 7: 126,409,641 I499F probably damaging Het
Cftr T A 6: 18,268,289 L749H probably benign Het
Clec2h G T 6: 128,675,827 G186W probably damaging Het
Cpsf3 T A 12: 21,296,732 I202N probably damaging Het
Crebbp G T 16: 4,087,736 T1669N possibly damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cul4a G A 8: 13,123,565 R204Q probably damaging Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Derl2 A G 11: 71,018,343 F43S probably damaging Het
Dnah14 T A 1: 181,763,960 N3348K probably damaging Het
Dnhd1 T C 7: 105,704,205 V2855A probably benign Het
Dpysl4 G T 7: 139,090,299 C27F probably benign Het
Fam228b G A 12: 4,748,314 A163V probably damaging Het
Fzd5 C A 1: 64,734,994 R536L probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gpr176 T A 2: 118,373,178 N4Y probably damaging Het
Grin3a T C 4: 49,665,309 I1109V possibly damaging Het
H2afy A G 13: 56,083,204 L287P probably damaging Het
Hcar1 T A 5: 123,879,029 I200F probably damaging Het
Heatr4 G A 12: 83,979,728 Q252* probably null Het
Hps1 G A 19: 42,762,449 H371Y probably damaging Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Kdm1b G A 13: 47,049,190 A34T probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Ltn1 A T 16: 87,416,343 D443E probably benign Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mb A G 15: 77,017,584 Y104H probably damaging Het
Mrc1 C A 2: 14,328,579 P1357Q probably benign Het
Nfib C T 4: 82,323,680 V425M probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1262 G A 2: 90,003,146 V247I probably benign Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr473 A G 7: 107,934,390 Y290C probably damaging Het
Olfr527 G A 7: 140,336,219 R119H possibly damaging Het
Olfr654 T C 7: 104,587,905 S34P probably damaging Het
Olfr732 A T 14: 50,281,391 Y287* probably null Het
Olfr784 T C 10: 129,388,086 F151S probably damaging Het
Olfr916 A T 9: 38,658,365 V9E probably damaging Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Prkaca T C 8: 83,981,223 S46P probably benign Het
Prkcb T G 7: 122,568,201 V378G probably damaging Het
Ptprf A T 4: 118,223,932 L576Q probably damaging Het
Rapgef4 T C 2: 72,234,720 V687A probably benign Het
Rsad2 C T 12: 26,450,617 V224I probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scn1a C T 2: 66,317,982 S1073N probably damaging Het
Slc26a3 A G 12: 31,465,846 M582V probably benign Het
Tbc1d32 A T 10: 56,123,537 Y846* probably null Het
Tbk1 A T 10: 121,547,171 M719K probably benign Het
Timeless A G 10: 128,246,114 K536R probably benign Het
Tle6 G T 10: 81,594,329 Q330K probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Toe1 T C 4: 116,805,229 Y273C probably damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ubxn11 G A 4: 134,124,838 S32N probably damaging Het
Usp8 G A 2: 126,756,040 C961Y probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r124 G T 17: 18,049,497 W5L probably benign Het
Vmn2r71 A T 7: 85,615,574 D38V probably damaging Het
Vmn2r87 C T 10: 130,479,886 V104I probably benign Het
Vmn2r97 C T 17: 18,947,386 T634I probably benign Het
Vps50 T C 6: 3,520,279 probably null Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Zfp14 C T 7: 30,038,691 V290M probably damaging Het
Zfp317 G A 9: 19,641,984 A18T possibly damaging Het
Zfp354b A T 11: 50,923,542 N185K probably benign Het
Zscan21 T A 5: 138,126,630 D269E probably benign Het
Other mutations in Fscn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:Fscn1 APN 5 142960620 missense possibly damaging 0.46
IGL02311:Fscn1 APN 5 142972010 missense probably benign 0.08
R0037:Fscn1 UTSW 5 142970694 splice site probably benign
R1163:Fscn1 UTSW 5 142960843 missense probably damaging 1.00
R4342:Fscn1 UTSW 5 142972021 missense probably damaging 1.00
R5569:Fscn1 UTSW 5 142961044 missense probably benign 0.13
R6248:Fscn1 UTSW 5 142961023 missense possibly damaging 0.94
R6517:Fscn1 UTSW 5 142971986 missense probably damaging 0.98
R6594:Fscn1 UTSW 5 142970028 missense probably benign 0.02
R6964:Fscn1 UTSW 5 142960660 missense probably damaging 1.00
R7000:Fscn1 UTSW 5 142960627 missense probably damaging 1.00
R7108:Fscn1 UTSW 5 142960515 missense not run
Predicted Primers PCR Primer
(F):5'- CCTGGAATCTGAGTGAGACAAG -3'
(R):5'- CACAAACTTGCCGTTGGAGG -3'

Sequencing Primer
(F):5'- TCACACAGTGGCCTGACC -3'
(R):5'- TGGAGGCTCTCAGAGTGATCC -3'
Posted On2014-06-23