Incidental Mutation 'R0110:Zfp423'
ID20385
Institutional Source Beutler Lab
Gene Symbol Zfp423
Ensembl Gene ENSMUSG00000045333
Gene Namezinc finger protein 423
SynonymsZfp104, ataxia1, Ebfaz, Roaz
MMRRC Submission 038396-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R0110 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location87661810-87959595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87782259 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 486 (S486P)
Ref Sequence ENSEMBL: ENSMUSP00000105282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052250] [ENSMUST00000109655] [ENSMUST00000165770] [ENSMUST00000174249] [ENSMUST00000174764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052250
AA Change: S465P

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052379
Gene: ENSMUSG00000045333
AA Change: S465P

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
ZnF_C2H2 54 75 5.07e0 SMART
low complexity region 107 123 N/A INTRINSIC
ZnF_C2H2 125 147 1.28e-3 SMART
ZnF_C2H2 153 175 1.64e-1 SMART
ZnF_C2H2 181 203 2.05e-2 SMART
ZnF_C2H2 209 231 3.21e-4 SMART
ZnF_C2H2 250 273 5.42e-2 SMART
ZnF_C2H2 282 305 1.76e-1 SMART
ZnF_C2H2 310 332 8.67e-1 SMART
low complexity region 350 364 N/A INTRINSIC
ZnF_C2H2 396 420 1.16e-1 SMART
ZnF_C2H2 428 451 3.52e-1 SMART
ZnF_C2H2 467 490 7.9e-4 SMART
low complexity region 492 503 N/A INTRINSIC
ZnF_C2H2 504 527 2.53e-2 SMART
ZnF_C2H2 550 575 3.99e0 SMART
low complexity region 591 602 N/A INTRINSIC
ZnF_C2H2 619 641 3.16e-3 SMART
ZnF_C2H2 649 671 5.81e-2 SMART
ZnF_C2H2 679 702 4.87e-4 SMART
ZnF_C2H2 707 730 7.26e-3 SMART
ZnF_C2H2 737 760 4.79e-3 SMART
ZnF_C2H2 768 790 1.36e-2 SMART
ZnF_C2H2 794 817 4.72e-2 SMART
ZnF_C2H2 873 896 4.12e0 SMART
ZnF_C2H2 917 939 5.59e-4 SMART
ZnF_C2H2 946 968 6.42e-4 SMART
ZnF_C2H2 975 997 4.94e0 SMART
ZnF_C2H2 1007 1029 4.99e1 SMART
Pfam:zf-C2H2_6 1050 1068 1.6e-1 PFAM
ZnF_C2H2 1107 1130 1.12e-3 SMART
ZnF_C2H2 1155 1177 1.45e-2 SMART
ZnF_C2H2 1185 1207 5.72e-1 SMART
ZnF_C2H2 1216 1239 1.18e-2 SMART
ZnF_C2H2 1246 1269 4.05e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109655
AA Change: S486P

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105282
Gene: ENSMUSG00000045333
AA Change: S486P

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
ZnF_C2H2 75 96 5.07e0 SMART
low complexity region 128 144 N/A INTRINSIC
ZnF_C2H2 146 168 1.28e-3 SMART
ZnF_C2H2 174 196 1.64e-1 SMART
ZnF_C2H2 202 224 2.05e-2 SMART
ZnF_C2H2 230 252 3.21e-4 SMART
ZnF_C2H2 271 294 5.42e-2 SMART
ZnF_C2H2 303 326 1.76e-1 SMART
ZnF_C2H2 331 353 8.67e-1 SMART
low complexity region 371 385 N/A INTRINSIC
ZnF_C2H2 417 441 1.16e-1 SMART
ZnF_C2H2 449 472 3.52e-1 SMART
ZnF_C2H2 488 511 7.9e-4 SMART
low complexity region 513 524 N/A INTRINSIC
ZnF_C2H2 525 548 2.53e-2 SMART
ZnF_C2H2 571 596 3.99e0 SMART
low complexity region 612 623 N/A INTRINSIC
ZnF_C2H2 640 662 3.16e-3 SMART
ZnF_C2H2 670 692 5.81e-2 SMART
ZnF_C2H2 700 723 4.87e-4 SMART
ZnF_C2H2 728 751 7.26e-3 SMART
ZnF_C2H2 758 781 4.79e-3 SMART
ZnF_C2H2 789 811 1.36e-2 SMART
ZnF_C2H2 815 838 4.72e-2 SMART
ZnF_C2H2 894 917 4.12e0 SMART
ZnF_C2H2 938 960 5.59e-4 SMART
ZnF_C2H2 967 989 6.42e-4 SMART
ZnF_C2H2 996 1018 4.94e0 SMART
ZnF_C2H2 1028 1050 4.99e1 SMART
ZnF_C2H2 1128 1151 1.12e-3 SMART
ZnF_C2H2 1176 1198 1.45e-2 SMART
ZnF_C2H2 1206 1228 5.72e-1 SMART
ZnF_C2H2 1237 1260 1.18e-2 SMART
ZnF_C2H2 1267 1290 4.05e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165770
AA Change: S361P

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129724
Gene: ENSMUSG00000045333
AA Change: S361P

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
ZnF_C2H2 21 43 1.28e-3 SMART
ZnF_C2H2 49 71 1.64e-1 SMART
ZnF_C2H2 77 99 2.05e-2 SMART
ZnF_C2H2 105 127 3.21e-4 SMART
ZnF_C2H2 146 169 5.42e-2 SMART
ZnF_C2H2 178 201 1.76e-1 SMART
ZnF_C2H2 206 228 8.67e-1 SMART
low complexity region 246 260 N/A INTRINSIC
ZnF_C2H2 292 316 1.16e-1 SMART
ZnF_C2H2 324 347 3.52e-1 SMART
ZnF_C2H2 363 386 7.9e-4 SMART
low complexity region 388 399 N/A INTRINSIC
ZnF_C2H2 400 423 2.53e-2 SMART
ZnF_C2H2 446 471 3.99e0 SMART
low complexity region 487 498 N/A INTRINSIC
ZnF_C2H2 515 537 3.16e-3 SMART
ZnF_C2H2 545 567 5.81e-2 SMART
ZnF_C2H2 575 598 4.87e-4 SMART
ZnF_C2H2 603 626 7.26e-3 SMART
ZnF_C2H2 633 656 4.79e-3 SMART
ZnF_C2H2 664 686 1.36e-2 SMART
ZnF_C2H2 690 713 4.72e-2 SMART
ZnF_C2H2 769 792 4.12e0 SMART
ZnF_C2H2 813 835 5.59e-4 SMART
ZnF_C2H2 842 864 6.42e-4 SMART
ZnF_C2H2 871 893 4.94e0 SMART
ZnF_C2H2 903 925 4.99e1 SMART
Pfam:zf-C2H2_6 946 964 2.5e-1 PFAM
ZnF_C2H2 1003 1026 1.12e-3 SMART
ZnF_C2H2 1051 1073 1.45e-2 SMART
ZnF_C2H2 1081 1103 5.72e-1 SMART
ZnF_C2H2 1112 1135 1.18e-2 SMART
ZnF_C2H2 1142 1165 4.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173725
Predicted Effect probably benign
Transcript: ENSMUST00000174249
SMART Domains Protein: ENSMUSP00000134103
Gene: ENSMUSG00000045333

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
ZnF_C2H2 78 100 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174764
SMART Domains Protein: ENSMUSP00000134575
Gene: ENSMUSG00000045333

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
ZnF_C2H2 78 99 5.07e0 SMART
low complexity region 131 147 N/A INTRINSIC
ZnF_C2H2 149 171 1.28e-3 SMART
ZnF_C2H2 177 199 1.64e-1 SMART
ZnF_C2H2 205 227 2.05e-2 SMART
Pfam:zf-C2H2_6 232 244 2.5e-1 PFAM
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that belongs to the family of Kruppel-like C2H2 zinc finger proteins. It functions as a DNA-binding transcription factor by using distinct zinc fingers in different signaling pathways. Thus, it is thought that this gene may have multiple roles in signal transduction during development. Mutations in this gene are associated with nephronophthisis-14 and Joubert syndrome-19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mutations in this gene lead to postnatal lethality, abnormal gait, ataxia, reduced body size, loss of the corpus callosum, reduction of the hippocampus, olfactory bulb defects, and variable malformation of the cerebellum, including vermis agenesis, due to reduced proliferation of neural precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,506 probably benign Het
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arpc1b T A 5: 145,127,715 W361R probably damaging Het
Baiap2l1 T C 5: 144,275,891 Y438C probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cntln C T 4: 85,096,757 T1095I probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dnah12 A G 14: 26,798,899 R1892G probably damaging Het
Dock4 A G 12: 40,621,312 probably benign Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Fam227b T A 2: 126,100,921 S319C probably damaging Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Gal3st2c C T 1: 94,009,497 P388L probably benign Het
Ggn C T 7: 29,171,296 P47S probably damaging Het
Gli3 T G 13: 15,724,785 L919R probably damaging Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 C A 1: 44,059,224 V905F probably benign Het
Gmip C T 8: 69,815,609 probably benign Het
Gpr39 C T 1: 125,677,500 T55M probably damaging Het
Grk4 A G 5: 34,716,213 T208A probably damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hadhb T C 5: 30,169,485 probably benign Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpa A T 2: 130,679,418 probably benign Het
Klhl10 A G 11: 100,456,932 T605A probably benign Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lap3 T C 5: 45,495,290 probably benign Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map3k6 T C 4: 133,243,794 L273P probably damaging Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mrc1 T A 2: 14,238,542 probably benign Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtcl1 C T 17: 66,358,114 E1149K possibly damaging Het
Naca C T 10: 128,044,790 A1897V probably benign Het
Ncapg T C 5: 45,693,147 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pla2g4a T A 1: 149,840,647 M688L possibly damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Prmt1 A G 7: 44,978,801 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Prom2 T G 2: 127,531,113 S679R possibly damaging Het
Psen2 T C 1: 180,238,914 T153A probably damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Stam2 A T 2: 52,719,986 probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Tas2r123 T C 6: 132,847,332 V64A probably benign Het
Tnnc1 A G 14: 31,211,408 D149G probably damaging Het
Tpp2 T A 1: 43,978,504 V756E probably benign Het
Tpp2 A G 1: 43,999,693 D1133G probably damaging Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Tsen15 A G 1: 152,371,797 V148A probably damaging Het
Ttn T A 2: 76,864,328 probably benign Het
Ube2u A G 4: 100,486,673 I90V probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Wdr41 T C 13: 95,018,111 probably benign Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Other mutations in Zfp423
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Zfp423 APN 8 87781611 unclassified probably null
IGL01359:Zfp423 APN 8 87780662 missense probably damaging 1.00
IGL01780:Zfp423 APN 8 87781508 missense probably damaging 1.00
IGL02250:Zfp423 APN 8 87783255 missense probably damaging 1.00
IGL02301:Zfp423 APN 8 87781574 missense probably damaging 1.00
IGL02320:Zfp423 APN 8 87781602 missense probably damaging 1.00
IGL02804:Zfp423 APN 8 87782657 missense probably benign 0.02
IGL03090:Zfp423 APN 8 87781443 missense probably damaging 1.00
IGL03198:Zfp423 APN 8 87781676 missense possibly damaging 0.73
IGL03383:Zfp423 APN 8 87859452 nonsense probably null
swell UTSW 8 87686559 splice site probably null
R0142:Zfp423 UTSW 8 87780340 nonsense probably null
R0256:Zfp423 UTSW 8 87773634 nonsense probably null
R0538:Zfp423 UTSW 8 87782085 missense probably damaging 0.99
R0542:Zfp423 UTSW 8 87780609 missense probably damaging 1.00
R0614:Zfp423 UTSW 8 87782114 missense probably damaging 1.00
R1179:Zfp423 UTSW 8 87688072 missense probably damaging 0.97
R1417:Zfp423 UTSW 8 87773656 splice site probably null
R1429:Zfp423 UTSW 8 87686442 missense probably damaging 0.99
R1570:Zfp423 UTSW 8 87782558 missense probably benign 0.37
R2013:Zfp423 UTSW 8 87782397 missense probably benign 0.43
R2043:Zfp423 UTSW 8 87782618 missense probably damaging 1.00
R2064:Zfp423 UTSW 8 87781358 missense probably benign 0.04
R2108:Zfp423 UTSW 8 87781178 missense possibly damaging 0.73
R2358:Zfp423 UTSW 8 87780551 missense possibly damaging 0.56
R3177:Zfp423 UTSW 8 87782331 missense probably damaging 1.00
R3277:Zfp423 UTSW 8 87782331 missense probably damaging 1.00
R3738:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R3739:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R3773:Zfp423 UTSW 8 87780512 missense probably benign 0.03
R4034:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R4425:Zfp423 UTSW 8 87782973 missense probably damaging 1.00
R4611:Zfp423 UTSW 8 87688081 missense possibly damaging 0.90
R4700:Zfp423 UTSW 8 87781710 unclassified probably null
R4753:Zfp423 UTSW 8 87781446 missense probably benign 0.00
R4818:Zfp423 UTSW 8 87904500 missense probably benign 0.00
R5026:Zfp423 UTSW 8 87780674 missense probably damaging 1.00
R5190:Zfp423 UTSW 8 87782463 missense probably damaging 1.00
R5243:Zfp423 UTSW 8 87773647 missense probably benign 0.03
R5284:Zfp423 UTSW 8 87781677 missense possibly damaging 0.73
R5586:Zfp423 UTSW 8 87859340 missense possibly damaging 0.93
R5601:Zfp423 UTSW 8 87782009 missense probably damaging 1.00
R5671:Zfp423 UTSW 8 87782327 missense probably damaging 0.99
R5717:Zfp423 UTSW 8 87686559 splice site probably null
R5801:Zfp423 UTSW 8 87859362 missense probably damaging 0.99
R5917:Zfp423 UTSW 8 87782232 nonsense probably null
R5985:Zfp423 UTSW 8 87782146 missense possibly damaging 0.83
R6111:Zfp423 UTSW 8 87782687 missense probably damaging 0.99
R6306:Zfp423 UTSW 8 87782034 missense possibly damaging 0.64
R6770:Zfp423 UTSW 8 87781817 missense probably damaging 0.99
R6970:Zfp423 UTSW 8 87803779 missense probably benign 0.00
R7029:Zfp423 UTSW 8 87688066 missense probably damaging 0.99
R7060:Zfp423 UTSW 8 87782879 missense probably damaging 1.00
R7074:Zfp423 UTSW 8 87782432 missense probably benign 0.00
R7121:Zfp423 UTSW 8 87780861 missense probably damaging 1.00
R7242:Zfp423 UTSW 8 87904527 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACTGCAATGCGCCTGTTGGATG -3'
(R):5'- AGACTCCACCTTGAAGCCACTGAG -3'

Sequencing Primer
(F):5'- GTGCTCTGTGAGCGAGGAC -3'
(R):5'- TTCTAAGCGGGACTTTACCAG -3'
Posted On2013-04-11