Incidental Mutation 'R1861:Kcnh7'
ID203866
Institutional Source Beutler Lab
Gene Symbol Kcnh7
Ensembl Gene ENSMUSG00000059742
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 7
SynonymsKv11.3, 9330137I11Rik, erg3
MMRRC Submission 039884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R1861 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location62693414-63184287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62777392 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 615 (V615A)
Ref Sequence ENSEMBL: ENSMUSP00000074563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075052]
Predicted Effect probably damaging
Transcript: ENSMUST00000075052
AA Change: V615A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074563
Gene: ENSMUSG00000059742
AA Change: V615A

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Pfam:Ion_trans 407 674 4.9e-39 PFAM
Pfam:Ion_trans_2 588 668 3.2e-13 PFAM
cNMP 745 863 1.5e-23 SMART
low complexity region 921 940 N/A INTRINSIC
coiled coil region 1022 1058 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,783 Y206C probably damaging Het
2610507B11Rik C T 11: 78,287,929 probably benign Het
4930579C12Rik C A 9: 89,152,831 noncoding transcript Het
4933417A18Rik A T 13: 34,932,507 I80F possibly damaging Het
9530053A07Rik A G 7: 28,154,732 Y1707C probably damaging Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Actr1a T C 19: 46,384,275 E87G probably damaging Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Alg2 T A 4: 47,471,670 K379N probably benign Het
Alk G T 17: 71,874,938 probably benign Het
Arhgef17 A G 7: 100,882,268 Y331H probably damaging Het
Art3 A G 5: 92,412,235 probably benign Het
Asap1 G A 15: 64,135,798 probably benign Het
Atad2 A T 15: 58,096,718 probably null Het
Atp8b5 G A 4: 43,372,906 R1150H probably damaging Het
B020004J07Rik A T 4: 101,836,938 D249E probably benign Het
Brdt T C 5: 107,359,458 S575P probably benign Het
Capn3 T A 2: 120,486,482 probably benign Het
Casd1 T A 6: 4,640,951 Y691N probably damaging Het
Ccdc127 T G 13: 74,356,979 H215Q possibly damaging Het
Cenpe T C 3: 135,268,979 L2300P probably damaging Het
Clasp1 T C 1: 118,570,931 F898L possibly damaging Het
Clcn1 C A 6: 42,313,991 P933Q possibly damaging Het
Cntn3 T A 6: 102,245,071 N489I probably benign Het
Col16a1 T C 4: 130,061,724 probably benign Het
Col24a1 G A 3: 145,537,267 probably null Het
Col8a2 C T 4: 126,311,624 probably benign Het
Cpd T C 11: 76,784,382 probably benign Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cyp2c40 T C 19: 39,786,875 Y311C probably benign Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Dennd5b T A 6: 149,068,262 N231I probably damaging Het
Dgkh T A 14: 78,578,792 H936L probably benign Het
Dmtf1 T C 5: 9,120,347 probably null Het
Dnaic2 T C 11: 114,752,951 V481A possibly damaging Het
Dpyd T G 3: 118,917,131 V396G probably damaging Het
Elmo3 A G 8: 105,308,581 D448G probably damaging Het
Emsy A T 7: 98,641,615 V100E probably damaging Het
Erbb2 T C 11: 98,412,737 probably null Het
Faah T C 4: 116,008,235 K85R probably benign Het
Fam149a A T 8: 45,339,362 Y686* probably null Het
Fat4 T C 3: 39,010,484 V4863A probably benign Het
Fbxl8 A G 8: 105,268,929 T358A probably damaging Het
Fgfr3 A G 5: 33,729,746 T165A probably damaging Het
Fnbp1l A T 3: 122,560,932 H180Q probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gstcd G T 3: 132,983,107 N627K probably damaging Het
Gtf2a1l G A 17: 88,714,954 V458I probably damaging Het
Gtf3c3 T C 1: 54,438,838 E26G possibly damaging Het
Hrct1 A T 4: 43,727,404 T15S probably benign Het
Ift122 C A 6: 115,891,928 R459S probably damaging Het
Irf1 T A 11: 53,774,357 C187S possibly damaging Het
Kif1c T C 11: 70,703,342 S61P probably damaging Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
Mark2 T C 19: 7,290,763 D25G possibly damaging Het
Me2 T C 18: 73,785,714 D432G probably benign Het
Mfap3 T C 11: 57,528,206 V64A probably benign Het
Nadk2 T A 15: 9,108,311 M416K probably benign Het
Ndufs1 C T 1: 63,147,417 G631D probably benign Het
Nomo1 G A 7: 46,078,101 V1055I probably benign Het
Nuggc T A 14: 65,642,001 probably benign Het
Nwd2 T C 5: 63,804,854 S594P probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr250 C T 9: 38,367,606 S10L probably benign Het
Olfr273 T A 4: 52,856,373 I47L probably benign Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Palm2 A G 4: 57,709,468 I138V probably damaging Het
Pcyt2 G A 11: 120,611,142 P332S probably benign Het
Phf14 A T 6: 11,987,611 M630L probably benign Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Pif1 A T 9: 65,589,453 I283F probably damaging Het
Pknox2 G A 9: 36,923,661 H171Y probably damaging Het
Prkg2 T A 5: 98,947,416 D632V probably damaging Het
Prr29 G A 11: 106,375,438 A6T probably damaging Het
Rims1 T A 1: 22,596,558 Y114F probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scnn1b G A 7: 121,914,261 C399Y probably damaging Het
Scp2 T C 4: 108,091,321 Y153C probably damaging Het
Sema3d A G 5: 12,497,603 K164R probably benign Het
Siglecf A G 7: 43,352,224 T153A probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Skint2 T C 4: 112,647,118 probably benign Het
Slc22a8 G A 19: 8,606,139 R236H probably damaging Het
Slc25a40 T A 5: 8,442,431 probably null Het
Slc26a5 T C 5: 21,816,958 D490G possibly damaging Het
Slc26a7 G T 4: 14,522,873 D482E probably benign Het
Smarca2 A T 19: 26,623,884 M77L probably benign Het
Sos2 A G 12: 69,617,363 L449P probably damaging Het
Spaca1 A G 4: 34,044,206 V96A probably damaging Het
Spata31d1b T A 13: 59,717,336 I766N possibly damaging Het
Specc1l T C 10: 75,309,859 Y1113H probably damaging Het
Speg A G 1: 75,389,005 R677G probably damaging Het
Taf5l A T 8: 123,997,990 D363E probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Trrap T A 5: 144,815,917 probably null Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ttn A T 2: 76,772,648 I18410K probably benign Het
V1rd19 T A 7: 24,003,724 V205D probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r95 T G 17: 18,452,268 C756G probably damaging Het
Wdr63 T C 3: 146,083,046 Y260C probably damaging Het
Zc3h15 A G 2: 83,663,990 T421A unknown Het
Zc3hc1 T C 6: 30,374,838 T235A probably benign Het
Zcchc14 A G 8: 121,609,251 probably benign Het
Zfp318 T A 17: 46,411,440 N1456K possibly damaging Het
Zfp606 A G 7: 12,480,931 probably benign Het
Zfp811 T A 17: 32,797,425 H546L probably damaging Het
Zfp94 A T 7: 24,309,116 Y33N probably damaging Het
Zfyve9 G T 4: 108,682,295 probably benign Het
Other mutations in Kcnh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kcnh7 APN 2 62764691 missense probably benign 0.01
IGL00693:Kcnh7 APN 2 62734254 missense probably benign 0.06
IGL00776:Kcnh7 APN 2 62850376 missense probably benign 0.00
IGL00956:Kcnh7 APN 2 62777639 missense probably damaging 1.00
IGL01651:Kcnh7 APN 2 62734284 missense possibly damaging 0.47
IGL01780:Kcnh7 APN 2 62837163 missense probably benign 0.17
IGL01859:Kcnh7 APN 2 62721788 missense probably benign 0.00
IGL02213:Kcnh7 APN 2 62739362 missense probably damaging 1.00
IGL02302:Kcnh7 APN 2 62706058 missense probably damaging 1.00
IGL02526:Kcnh7 APN 2 62850437 missense possibly damaging 0.46
IGL02850:Kcnh7 APN 2 62787685 nonsense probably null
IGL02989:Kcnh7 APN 2 62721925 missense probably benign
IGL02990:Kcnh7 APN 2 62705986 missense probably benign 0.11
LCD18:Kcnh7 UTSW 2 63049799 intron probably benign
R0129:Kcnh7 UTSW 2 62716159 missense probably benign 0.00
R0622:Kcnh7 UTSW 2 62837289 splice site probably null
R0638:Kcnh7 UTSW 2 62777510 missense probably benign 0.13
R1006:Kcnh7 UTSW 2 62716183 missense probably benign 0.00
R1200:Kcnh7 UTSW 2 62777395 missense probably damaging 1.00
R1330:Kcnh7 UTSW 2 62777411 missense possibly damaging 0.56
R1614:Kcnh7 UTSW 2 62850604 missense probably benign 0.03
R1782:Kcnh7 UTSW 2 62736169 missense probably damaging 1.00
R1862:Kcnh7 UTSW 2 62787754 missense possibly damaging 0.46
R2197:Kcnh7 UTSW 2 62777606 missense probably damaging 1.00
R2510:Kcnh7 UTSW 2 62721917 missense probably benign
R2988:Kcnh7 UTSW 2 62721828 missense probably benign 0.20
R3024:Kcnh7 UTSW 2 62764663 missense probably damaging 1.00
R3433:Kcnh7 UTSW 2 62721917 missense probably benign
R4415:Kcnh7 UTSW 2 62706073 missense probably damaging 1.00
R4540:Kcnh7 UTSW 2 62739186 missense probably damaging 1.00
R4570:Kcnh7 UTSW 2 62837095 missense possibly damaging 0.91
R4827:Kcnh7 UTSW 2 62716220 missense probably benign
R4990:Kcnh7 UTSW 2 62734288 missense probably benign 0.00
R5172:Kcnh7 UTSW 2 62739164 missense possibly damaging 0.88
R5822:Kcnh7 UTSW 2 62716238 missense probably benign
R5996:Kcnh7 UTSW 2 63184097 start gained probably benign
R6142:Kcnh7 UTSW 2 62739360 missense possibly damaging 0.95
R6226:Kcnh7 UTSW 2 62777559 missense probably damaging 1.00
R6244:Kcnh7 UTSW 2 63182226 missense probably damaging 1.00
R6304:Kcnh7 UTSW 2 62764616 nonsense probably null
R6400:Kcnh7 UTSW 2 62739344 missense probably damaging 1.00
R6430:Kcnh7 UTSW 2 62850532 missense probably benign 0.04
R6483:Kcnh7 UTSW 2 62845774 missense probably benign 0.06
R6614:Kcnh7 UTSW 2 62777596 missense probably damaging 1.00
R6753:Kcnh7 UTSW 2 62850377 missense probably benign
R6822:Kcnh7 UTSW 2 62787904 missense probably damaging 1.00
R6863:Kcnh7 UTSW 2 62787685 missense possibly damaging 0.83
R7104:Kcnh7 UTSW 2 62787687 missense possibly damaging 0.82
R7116:Kcnh7 UTSW 2 62877270 missense probably benign 0.02
R7263:Kcnh7 UTSW 2 62735970 splice site probably null
X0011:Kcnh7 UTSW 2 62764723 missense probably damaging 0.99
Z1088:Kcnh7 UTSW 2 62736103 missense probably damaging 1.00
Z1088:Kcnh7 UTSW 2 63184068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATCCACATGTGTAATCCCC -3'
(R):5'- CAGAATATGGTGCGGCTGTTC -3'

Sequencing Primer
(F):5'- ATGTGTAATCCCCCAATCTCTATAG -3'
(R):5'- CAGAATATGGTGCGGCTGTTCTAATG -3'
Posted On2014-06-23