Incidental Mutation 'R1861:Pif1'
List |< first << previous [record 75 of 114] next >> last >|
ID203934
Institutional Source Beutler Lab
Gene Symbol Pif1
Ensembl Gene ENSMUSG00000041064
Gene NamePIF1 5'-to-3' DNA helicase
SynonymsAI449441
MMRRC Submission 039884-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1861 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65587160-65595967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65589453 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 283 (I283F)
Ref Sequence ENSEMBL: ENSMUSP00000117085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047099] [ENSMUST00000131483] [ENSMUST00000134538] [ENSMUST00000136205] [ENSMUST00000141046] [ENSMUST00000154970]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047099
AA Change: I283F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049046
Gene: ENSMUSG00000041064
AA Change: I283F

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131483
AA Change: I283F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117494
Gene: ENSMUSG00000041064
AA Change: I283F

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134538
AA Change: I283F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122060
Gene: ENSMUSG00000041064
AA Change: I283F

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136205
Predicted Effect probably benign
Transcript: ENSMUST00000141046
SMART Domains Protein: ENSMUSP00000120400
Gene: ENSMUSG00000041064

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152885
Predicted Effect probably damaging
Transcript: ENSMUST00000154970
AA Change: I283F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117085
Gene: ENSMUSG00000041064
AA Change: I283F

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 410 1e-14 PFAM
Pfam:PIF1 215 410 8e-59 PFAM
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent adenosine triphosphate (ATP)-metabolizing enzyme that functions as a 5' to 3' DNA helicase. The encoded protein can resolve G-quadruplex structures and RNA-DNA hybrids at the ends of chromosomes. It also prevents telomere elongation by inhibiting the actions of telomerase. Alternative splicing and the use of alternative start codons results in multiple isoforms that are differentially localized to either the mitochondria or the nucleus. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and show no evidence of increased sensitivity to DNA damage, genetic instability, reproducible telomere length alteration or other cellular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,783 Y206C probably damaging Het
2610507B11Rik C T 11: 78,287,929 probably benign Het
4930579C12Rik C A 9: 89,152,831 noncoding transcript Het
4933417A18Rik A T 13: 34,932,507 I80F possibly damaging Het
9530053A07Rik A G 7: 28,154,732 Y1707C probably damaging Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Actr1a T C 19: 46,384,275 E87G probably damaging Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Alg2 T A 4: 47,471,670 K379N probably benign Het
Alk G T 17: 71,874,938 probably benign Het
Arhgef17 A G 7: 100,882,268 Y331H probably damaging Het
Art3 A G 5: 92,412,235 probably benign Het
Asap1 G A 15: 64,135,798 probably benign Het
Atad2 A T 15: 58,096,718 probably null Het
Atp8b5 G A 4: 43,372,906 R1150H probably damaging Het
B020004J07Rik A T 4: 101,836,938 D249E probably benign Het
Brdt T C 5: 107,359,458 S575P probably benign Het
Capn3 T A 2: 120,486,482 probably benign Het
Casd1 T A 6: 4,640,951 Y691N probably damaging Het
Ccdc127 T G 13: 74,356,979 H215Q possibly damaging Het
Cenpe T C 3: 135,268,979 L2300P probably damaging Het
Clasp1 T C 1: 118,570,931 F898L possibly damaging Het
Clcn1 C A 6: 42,313,991 P933Q possibly damaging Het
Cntn3 T A 6: 102,245,071 N489I probably benign Het
Col16a1 T C 4: 130,061,724 probably benign Het
Col24a1 G A 3: 145,537,267 probably null Het
Col8a2 C T 4: 126,311,624 probably benign Het
Cpd T C 11: 76,784,382 probably benign Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cyp2c40 T C 19: 39,786,875 Y311C probably benign Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Dennd5b T A 6: 149,068,262 N231I probably damaging Het
Dgkh T A 14: 78,578,792 H936L probably benign Het
Dmtf1 T C 5: 9,120,347 probably null Het
Dnaic2 T C 11: 114,752,951 V481A possibly damaging Het
Dpyd T G 3: 118,917,131 V396G probably damaging Het
Elmo3 A G 8: 105,308,581 D448G probably damaging Het
Emsy A T 7: 98,641,615 V100E probably damaging Het
Erbb2 T C 11: 98,412,737 probably null Het
Faah T C 4: 116,008,235 K85R probably benign Het
Fam149a A T 8: 45,339,362 Y686* probably null Het
Fat4 T C 3: 39,010,484 V4863A probably benign Het
Fbxl8 A G 8: 105,268,929 T358A probably damaging Het
Fgfr3 A G 5: 33,729,746 T165A probably damaging Het
Fnbp1l A T 3: 122,560,932 H180Q probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gstcd G T 3: 132,983,107 N627K probably damaging Het
Gtf2a1l G A 17: 88,714,954 V458I probably damaging Het
Gtf3c3 T C 1: 54,438,838 E26G possibly damaging Het
Hrct1 A T 4: 43,727,404 T15S probably benign Het
Ift122 C A 6: 115,891,928 R459S probably damaging Het
Irf1 T A 11: 53,774,357 C187S possibly damaging Het
Kcnh7 A G 2: 62,777,392 V615A probably damaging Het
Kif1c T C 11: 70,703,342 S61P probably damaging Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
Mark2 T C 19: 7,290,763 D25G possibly damaging Het
Me2 T C 18: 73,785,714 D432G probably benign Het
Mfap3 T C 11: 57,528,206 V64A probably benign Het
Nadk2 T A 15: 9,108,311 M416K probably benign Het
Ndufs1 C T 1: 63,147,417 G631D probably benign Het
Nomo1 G A 7: 46,078,101 V1055I probably benign Het
Nuggc T A 14: 65,642,001 probably benign Het
Nwd2 T C 5: 63,804,854 S594P probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr250 C T 9: 38,367,606 S10L probably benign Het
Olfr273 T A 4: 52,856,373 I47L probably benign Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Palm2 A G 4: 57,709,468 I138V probably damaging Het
Pcyt2 G A 11: 120,611,142 P332S probably benign Het
Phf14 A T 6: 11,987,611 M630L probably benign Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Pknox2 G A 9: 36,923,661 H171Y probably damaging Het
Prkg2 T A 5: 98,947,416 D632V probably damaging Het
Prr29 G A 11: 106,375,438 A6T probably damaging Het
Rims1 T A 1: 22,596,558 Y114F probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scnn1b G A 7: 121,914,261 C399Y probably damaging Het
Scp2 T C 4: 108,091,321 Y153C probably damaging Het
Sema3d A G 5: 12,497,603 K164R probably benign Het
Siglecf A G 7: 43,352,224 T153A probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Skint2 T C 4: 112,647,118 probably benign Het
Slc22a8 G A 19: 8,606,139 R236H probably damaging Het
Slc25a40 T A 5: 8,442,431 probably null Het
Slc26a5 T C 5: 21,816,958 D490G possibly damaging Het
Slc26a7 G T 4: 14,522,873 D482E probably benign Het
Smarca2 A T 19: 26,623,884 M77L probably benign Het
Sos2 A G 12: 69,617,363 L449P probably damaging Het
Spaca1 A G 4: 34,044,206 V96A probably damaging Het
Spata31d1b T A 13: 59,717,336 I766N possibly damaging Het
Specc1l T C 10: 75,309,859 Y1113H probably damaging Het
Speg A G 1: 75,389,005 R677G probably damaging Het
Taf5l A T 8: 123,997,990 D363E probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Trrap T A 5: 144,815,917 probably null Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ttn A T 2: 76,772,648 I18410K probably benign Het
V1rd19 T A 7: 24,003,724 V205D probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r95 T G 17: 18,452,268 C756G probably damaging Het
Wdr63 T C 3: 146,083,046 Y260C probably damaging Het
Zc3h15 A G 2: 83,663,990 T421A unknown Het
Zc3hc1 T C 6: 30,374,838 T235A probably benign Het
Zcchc14 A G 8: 121,609,251 probably benign Het
Zfp318 T A 17: 46,411,440 N1456K possibly damaging Het
Zfp606 A G 7: 12,480,931 probably benign Het
Zfp811 T A 17: 32,797,425 H546L probably damaging Het
Zfp94 A T 7: 24,309,116 Y33N probably damaging Het
Zfyve9 G T 4: 108,682,295 probably benign Het
Other mutations in Pif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pif1 APN 9 65593277 missense probably damaging 1.00
IGL01343:Pif1 APN 9 65589562 missense probably damaging 1.00
IGL01753:Pif1 APN 9 65593308 missense probably damaging 1.00
R0415:Pif1 UTSW 9 65588051 missense probably benign 0.00
R1087:Pif1 UTSW 9 65589095 missense probably benign
R1742:Pif1 UTSW 9 65587850 missense probably benign 0.12
R3804:Pif1 UTSW 9 65588306 missense probably damaging 0.99
R3950:Pif1 UTSW 9 65591834 missense probably damaging 1.00
R4457:Pif1 UTSW 9 65587776 utr 5 prime probably benign
R4853:Pif1 UTSW 9 65593576 missense probably damaging 1.00
R5192:Pif1 UTSW 9 65588092 missense probably benign 0.02
R5196:Pif1 UTSW 9 65588092 missense probably benign 0.02
R5269:Pif1 UTSW 9 65591829 missense possibly damaging 0.82
R6703:Pif1 UTSW 9 65593263 missense probably damaging 1.00
X0064:Pif1 UTSW 9 65594478 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GAAACATATCCTGGGTTCCCTG -3'
(R):5'- ACTCAGGTCTCAGTGACTGC -3'

Sequencing Primer
(F):5'- CTACTGGTACTGTGGCCACTG -3'
(R):5'- AGGTCTCAGTGACTGCCCTTG -3'
Posted On2014-06-23