Incidental Mutation 'R1861:Dnaic2'
ID203945
Institutional Source Beutler Lab
Gene Symbol Dnaic2
Ensembl Gene ENSMUSG00000034706
Gene Namedynein, axonemal, intermediate chain 2
Synonyms
MMRRC Submission 039884-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R1861 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location114727408-114757889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114752951 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 481 (V481A)
Ref Sequence ENSEMBL: ENSMUSP00000090126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069325] [ENSMUST00000092469] [ENSMUST00000141762]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069325
AA Change: V481A

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065787
Gene: ENSMUSG00000034706
AA Change: V481A

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
WD40 441 480 4.93e1 SMART
low complexity region 519 545 N/A INTRINSIC
low complexity region 559 608 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092469
AA Change: V481A

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090126
Gene: ENSMUSG00000034706
AA Change: V481A

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
WD40 441 480 4.93e1 SMART
low complexity region 519 545 N/A INTRINSIC
low complexity region 559 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136403
Predicted Effect probably benign
Transcript: ENSMUST00000141762
AA Change: V469A

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114700
Gene: ENSMUSG00000034706
AA Change: V469A

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
low complexity region 458 476 N/A INTRINSIC
low complexity region 507 533 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144872
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dynein intermediate chain family, and is part of the dynein complex of respiratory cilia and sperm flagella. Mutations in this gene are associated with primary ciliary dyskinesia type 9. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit situs inversus totalis and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,783 Y206C probably damaging Het
2610507B11Rik C T 11: 78,287,929 probably benign Het
4930579C12Rik C A 9: 89,152,831 noncoding transcript Het
4933417A18Rik A T 13: 34,932,507 I80F possibly damaging Het
9530053A07Rik A G 7: 28,154,732 Y1707C probably damaging Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Actr1a T C 19: 46,384,275 E87G probably damaging Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Alg2 T A 4: 47,471,670 K379N probably benign Het
Alk G T 17: 71,874,938 probably benign Het
Arhgef17 A G 7: 100,882,268 Y331H probably damaging Het
Art3 A G 5: 92,412,235 probably benign Het
Asap1 G A 15: 64,135,798 probably benign Het
Atad2 A T 15: 58,096,718 probably null Het
Atp8b5 G A 4: 43,372,906 R1150H probably damaging Het
B020004J07Rik A T 4: 101,836,938 D249E probably benign Het
Brdt T C 5: 107,359,458 S575P probably benign Het
Capn3 T A 2: 120,486,482 probably benign Het
Casd1 T A 6: 4,640,951 Y691N probably damaging Het
Ccdc127 T G 13: 74,356,979 H215Q possibly damaging Het
Cenpe T C 3: 135,268,979 L2300P probably damaging Het
Clasp1 T C 1: 118,570,931 F898L possibly damaging Het
Clcn1 C A 6: 42,313,991 P933Q possibly damaging Het
Cntn3 T A 6: 102,245,071 N489I probably benign Het
Col16a1 T C 4: 130,061,724 probably benign Het
Col24a1 G A 3: 145,537,267 probably null Het
Col8a2 C T 4: 126,311,624 probably benign Het
Cpd T C 11: 76,784,382 probably benign Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cyp2c40 T C 19: 39,786,875 Y311C probably benign Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Dennd5b T A 6: 149,068,262 N231I probably damaging Het
Dgkh T A 14: 78,578,792 H936L probably benign Het
Dmtf1 T C 5: 9,120,347 probably null Het
Dpyd T G 3: 118,917,131 V396G probably damaging Het
Elmo3 A G 8: 105,308,581 D448G probably damaging Het
Emsy A T 7: 98,641,615 V100E probably damaging Het
Erbb2 T C 11: 98,412,737 probably null Het
Faah T C 4: 116,008,235 K85R probably benign Het
Fam149a A T 8: 45,339,362 Y686* probably null Het
Fat4 T C 3: 39,010,484 V4863A probably benign Het
Fbxl8 A G 8: 105,268,929 T358A probably damaging Het
Fgfr3 A G 5: 33,729,746 T165A probably damaging Het
Fnbp1l A T 3: 122,560,932 H180Q probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gstcd G T 3: 132,983,107 N627K probably damaging Het
Gtf2a1l G A 17: 88,714,954 V458I probably damaging Het
Gtf3c3 T C 1: 54,438,838 E26G possibly damaging Het
Hrct1 A T 4: 43,727,404 T15S probably benign Het
Ift122 C A 6: 115,891,928 R459S probably damaging Het
Irf1 T A 11: 53,774,357 C187S possibly damaging Het
Kcnh7 A G 2: 62,777,392 V615A probably damaging Het
Kif1c T C 11: 70,703,342 S61P probably damaging Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
Mark2 T C 19: 7,290,763 D25G possibly damaging Het
Me2 T C 18: 73,785,714 D432G probably benign Het
Mfap3 T C 11: 57,528,206 V64A probably benign Het
Nadk2 T A 15: 9,108,311 M416K probably benign Het
Ndufs1 C T 1: 63,147,417 G631D probably benign Het
Nomo1 G A 7: 46,078,101 V1055I probably benign Het
Nuggc T A 14: 65,642,001 probably benign Het
Nwd2 T C 5: 63,804,854 S594P probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr250 C T 9: 38,367,606 S10L probably benign Het
Olfr273 T A 4: 52,856,373 I47L probably benign Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Palm2 A G 4: 57,709,468 I138V probably damaging Het
Pcyt2 G A 11: 120,611,142 P332S probably benign Het
Phf14 A T 6: 11,987,611 M630L probably benign Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Pif1 A T 9: 65,589,453 I283F probably damaging Het
Pknox2 G A 9: 36,923,661 H171Y probably damaging Het
Prkg2 T A 5: 98,947,416 D632V probably damaging Het
Prr29 G A 11: 106,375,438 A6T probably damaging Het
Rims1 T A 1: 22,596,558 Y114F probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scnn1b G A 7: 121,914,261 C399Y probably damaging Het
Scp2 T C 4: 108,091,321 Y153C probably damaging Het
Sema3d A G 5: 12,497,603 K164R probably benign Het
Siglecf A G 7: 43,352,224 T153A probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Skint2 T C 4: 112,647,118 probably benign Het
Slc22a8 G A 19: 8,606,139 R236H probably damaging Het
Slc25a40 T A 5: 8,442,431 probably null Het
Slc26a5 T C 5: 21,816,958 D490G possibly damaging Het
Slc26a7 G T 4: 14,522,873 D482E probably benign Het
Smarca2 A T 19: 26,623,884 M77L probably benign Het
Sos2 A G 12: 69,617,363 L449P probably damaging Het
Spaca1 A G 4: 34,044,206 V96A probably damaging Het
Spata31d1b T A 13: 59,717,336 I766N possibly damaging Het
Specc1l T C 10: 75,309,859 Y1113H probably damaging Het
Speg A G 1: 75,389,005 R677G probably damaging Het
Taf5l A T 8: 123,997,990 D363E probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Trrap T A 5: 144,815,917 probably null Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ttn A T 2: 76,772,648 I18410K probably benign Het
V1rd19 T A 7: 24,003,724 V205D probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r95 T G 17: 18,452,268 C756G probably damaging Het
Wdr63 T C 3: 146,083,046 Y260C probably damaging Het
Zc3h15 A G 2: 83,663,990 T421A unknown Het
Zc3hc1 T C 6: 30,374,838 T235A probably benign Het
Zcchc14 A G 8: 121,609,251 probably benign Het
Zfp318 T A 17: 46,411,440 N1456K possibly damaging Het
Zfp606 A G 7: 12,480,931 probably benign Het
Zfp811 T A 17: 32,797,425 H546L probably damaging Het
Zfp94 A T 7: 24,309,116 Y33N probably damaging Het
Zfyve9 G T 4: 108,682,295 probably benign Het
Other mutations in Dnaic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Dnaic2 APN 11 114751788 missense probably benign 0.37
IGL01548:Dnaic2 APN 11 114752942 missense probably damaging 1.00
IGL02719:Dnaic2 APN 11 114751911 missense probably damaging 1.00
IGL03236:Dnaic2 APN 11 114757249 unclassified probably benign
R0096:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R0096:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R0305:Dnaic2 UTSW 11 114752894 missense probably benign 0.09
R0472:Dnaic2 UTSW 11 114745189 splice site probably benign
R0711:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R1756:Dnaic2 UTSW 11 114750380 missense probably benign 0.02
R1916:Dnaic2 UTSW 11 114732923 missense possibly damaging 0.88
R1981:Dnaic2 UTSW 11 114732929 missense probably damaging 1.00
R1983:Dnaic2 UTSW 11 114735856 splice site probably null
R2430:Dnaic2 UTSW 11 114757186 unclassified probably benign
R2510:Dnaic2 UTSW 11 114757167 unclassified probably benign
R3001:Dnaic2 UTSW 11 114750471 missense probably damaging 1.00
R3002:Dnaic2 UTSW 11 114750471 missense probably damaging 1.00
R3113:Dnaic2 UTSW 11 114751930 splice site probably null
R3803:Dnaic2 UTSW 11 114738725 missense probably benign
R3874:Dnaic2 UTSW 11 114732955 missense probably damaging 1.00
R4853:Dnaic2 UTSW 11 114745091 missense probably benign 0.03
R5267:Dnaic2 UTSW 11 114740467 missense probably benign 0.02
R6008:Dnaic2 UTSW 11 114752990 missense probably benign 0.01
R6024:Dnaic2 UTSW 11 114752908 missense possibly damaging 0.85
R6819:Dnaic2 UTSW 11 114745091 missense probably benign 0.00
R7053:Dnaic2 UTSW 11 114738695 missense probably damaging 1.00
R7143:Dnaic2 UTSW 11 114754250 missense not run
Predicted Primers PCR Primer
(F):5'- ATTCACAGTGGAAGGGTGTG -3'
(R):5'- AGATCTGACAGCTTGGGGAC -3'

Sequencing Primer
(F):5'- GGGTGTTCCAATAGGGCC -3'
(R):5'- GACCCCATGCTGCCCTC -3'
Posted On2014-06-23