Incidental Mutation 'R1862:Tank'
ID203992
Institutional Source Beutler Lab
Gene Symbol Tank
Ensembl Gene ENSMUSG00000064289
Gene NameTRAF family member-associated Nf-kappa B activator
SynonymsE430026L09Rik, I-TRAF
MMRRC Submission 039885-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.759) question?
Stock #R1862 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location61578585-61654171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61649912 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 264 (F264S)
Ref Sequence ENSEMBL: ENSMUSP00000108121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078074] [ENSMUST00000112494] [ENSMUST00000112495] [ENSMUST00000112501] [ENSMUST00000112502]
Predicted Effect probably damaging
Transcript: ENSMUST00000078074
AA Change: F265S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077219
Gene: ENSMUSG00000064289
AA Change: F265S

DomainStartEndE-ValueType
coiled coil region 60 98 N/A INTRINSIC
Pfam:TBD 165 219 1.2e-27 PFAM
ZnF_C2H2 417 443 1.81e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112494
AA Change: F230S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108113
Gene: ENSMUSG00000064289
AA Change: F230S

DomainStartEndE-ValueType
coiled coil region 22 63 N/A INTRINSIC
Pfam:TBD 128 184 5.9e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112495
AA Change: F230S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108114
Gene: ENSMUSG00000064289
AA Change: F230S

DomainStartEndE-ValueType
coiled coil region 22 63 N/A INTRINSIC
Pfam:TBD 128 184 1.3e-33 PFAM
ZnF_C2H2 382 408 1.81e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112501
AA Change: F231S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108120
Gene: ENSMUSG00000064289
AA Change: F231S

DomainStartEndE-ValueType
coiled coil region 26 64 N/A INTRINSIC
Pfam:TBD 129 185 1.3e-33 PFAM
ZnF_C2H2 383 409 1.81e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112502
AA Change: F264S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108121
Gene: ENSMUSG00000064289
AA Change: F264S

DomainStartEndE-ValueType
coiled coil region 56 97 N/A INTRINSIC
Pfam:TBD 162 218 8.2e-34 PFAM
ZnF_C2H2 416 442 1.81e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154693
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TRAF (tumor necrosis factor receptor-associated factor) family of proteins associate with and transduce signals from members of the tumor necrosis factor receptor superfamily. The protein encoded by this gene is found in the cytoplasm and can bind to TRAF1, TRAF2, or TRAF3, thereby inhibiting TRAF function by sequestering the TRAFs in a latent state in the cytoplasm. For example, the protein encoded by this gene can block TRAF2 binding to LMP1, the Epstein-Barr virus transforming protein, and inhibit LMP1-mediated NF-kappa-B activation. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice develop fatal glomerulonephritis owing to deposition of immune complexes. Dendritic cells, macrophages and B cells from these mice are hyper-responsive to stimuli leading to increased production of immunoglobulins and inflammatory cytokines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 E565D probably benign Het
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col16a1 G A 4: 130,092,782 probably null Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dnah12 A G 14: 26,697,398 D147G probably benign Het
Dnah12 A T 14: 26,709,257 Y340F probably benign Het
Dot1l G T 10: 80,783,539 R193L probably damaging Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hdc T A 2: 126,597,933 I367F probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mapk1 T A 16: 17,026,429 S22T probably benign Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Papss1 T A 3: 131,583,184 V170D possibly damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pde3a T A 6: 141,250,353 I255N probably damaging Het
Pde3a G T 6: 141,487,513 A757S probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Ubap2 A G 4: 41,221,607 S231P probably benign Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Tank
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02994:Tank APN 2 61650292 splice site probably benign
malade UTSW 2 61644424 critical splice donor site probably null
R1620:Tank UTSW 2 61650098 missense possibly damaging 0.92
R1671:Tank UTSW 2 61649753 missense probably damaging 0.99
R3918:Tank UTSW 2 61643786 critical splice donor site probably null
R4714:Tank UTSW 2 61650229 missense probably benign 0.01
R4727:Tank UTSW 2 61653532 missense probably benign 0.05
R4865:Tank UTSW 2 61578635 start gained probably benign
R4867:Tank UTSW 2 61578635 start gained probably benign
R5023:Tank UTSW 2 61578635 start gained probably benign
R5213:Tank UTSW 2 61649948 missense probably benign 0.01
R5562:Tank UTSW 2 61650208 missense possibly damaging 0.59
R5950:Tank UTSW 2 61653569 utr 3 prime probably benign
R6221:Tank UTSW 2 61650083 missense probably damaging 1.00
R6626:Tank UTSW 2 61650296 splice site probably benign
R6670:Tank UTSW 2 61644424 critical splice donor site probably null
R6850:Tank UTSW 2 61650002 missense probably benign 0.19
R7027:Tank UTSW 2 61653422 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGTTCTGTGCCTATACAGTG -3'
(R):5'- ACGTCGCTCTAAGATTTGAGGG -3'

Sequencing Primer
(F):5'- TCTGTGCCTATACAGTGTACTG -3'
(R):5'- AGCTGAAGTTATGGGGTCAATTCCC -3'
Posted On2014-06-23