Incidental Mutation 'R1862:Col16a1'
ID204006
Institutional Source Beutler Lab
Gene Symbol Col16a1
Ensembl Gene ENSMUSG00000040690
Gene Namecollagen, type XVI, alpha 1
Synonyms2700007F12Rik, [a]1 (XVI) collagen, A530052M23Rik
MMRRC Submission 039885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R1862 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location130047840-130099283 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 130092782 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044565] [ENSMUST00000143432] [ENSMUST00000143577] [ENSMUST00000143577]
Predicted Effect probably null
Transcript: ENSMUST00000044565
SMART Domains Protein: ENSMUSP00000035802
Gene: ENSMUSG00000040690

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_4 330 355 2.35e-7 PROSPERO
Pfam:Collagen 372 431 1.6e-8 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_2 546 562 2.68e-9 PROSPERO
internal_repeat_1 547 580 9.92e-10 PROSPERO
Pfam:Collagen 584 646 1.5e-9 PFAM
internal_repeat_5 662 689 6.35e-7 PROSPERO
internal_repeat_3 662 731 1.96e-8 PROSPERO
internal_repeat_7 679 695 2.06e-5 PROSPERO
internal_repeat_6 682 730 7.63e-6 PROSPERO
internal_repeat_1 685 742 9.92e-10 PROSPERO
Pfam:Collagen 796 850 3.4e-9 PFAM
internal_repeat_5 859 889 6.35e-7 PROSPERO
low complexity region 891 922 N/A INTRINSIC
low complexity region 990 1000 N/A INTRINSIC
Pfam:Collagen 1001 1064 1.4e-10 PFAM
low complexity region 1090 1112 N/A INTRINSIC
internal_repeat_7 1114 1130 2.06e-5 PROSPERO
low complexity region 1132 1162 N/A INTRINSIC
low complexity region 1171 1222 N/A INTRINSIC
low complexity region 1230 1282 N/A INTRINSIC
internal_repeat_2 1283 1299 2.68e-9 PROSPERO
internal_repeat_6 1287 1335 7.63e-6 PROSPERO
Pfam:Collagen 1350 1411 1.8e-9 PFAM
Pfam:Collagen 1446 1503 5.3e-10 PFAM
low complexity region 1505 1525 N/A INTRINSIC
low complexity region 1528 1549 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135675
Predicted Effect probably benign
Transcript: ENSMUST00000143432
SMART Domains Protein: ENSMUSP00000120384
Gene: ENSMUSG00000040690

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_1 330 353 5.41e-8 PROSPERO
Pfam:Collagen 372 426 2.1e-9 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_1 546 569 5.41e-8 PROSPERO
internal_repeat_2 547 580 5.41e-8 PROSPERO
Pfam:Collagen 584 646 2.7e-10 PFAM
Pfam:Collagen 659 736 8.6e-8 PFAM
Pfam:Collagen 745 797 1.6e-7 PFAM
Pfam:Collagen 796 850 5.9e-10 PFAM
Pfam:Collagen 848 923 1.6e-7 PFAM
low complexity region 974 984 N/A INTRINSIC
Pfam:Collagen 987 1045 1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143577
SMART Domains Protein: ENSMUSP00000120339
Gene: ENSMUSG00000040690

DomainStartEndE-ValueType
internal_repeat_7 1 43 5.7e-5 PROSPERO
Pfam:Collagen 57 112 2e-9 PFAM
low complexity region 126 192 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 231 247 1.5e-10 PROSPERO
internal_repeat_1 232 265 5.16e-11 PROSPERO
Pfam:Collagen 269 331 3.4e-10 PFAM
Pfam:Collagen 360 421 7e-11 PFAM
Pfam:Collagen 430 482 1.9e-7 PFAM
Pfam:Collagen 481 535 7.8e-10 PFAM
Pfam:Collagen 560 623 1.4e-7 PFAM
internal_repeat_9 640 665 9.73e-5 PROSPERO
low complexity region 675 685 N/A INTRINSIC
Pfam:Collagen 686 747 2.5e-11 PFAM
Pfam:Collagen 730 802 5.2e-9 PFAM
Pfam:Collagen 783 860 9.2e-9 PFAM
low complexity region 871 922 N/A INTRINSIC
low complexity region 930 985 N/A INTRINSIC
internal_repeat_2 986 1002 1.5e-10 PROSPERO
internal_repeat_5 990 1038 7.88e-7 PROSPERO
low complexity region 1041 1110 N/A INTRINSIC
Pfam:Collagen 1149 1205 1.8e-10 PFAM
Pfam:Collagen 1203 1260 1.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143577
SMART Domains Protein: ENSMUSP00000120339
Gene: ENSMUSG00000040690

DomainStartEndE-ValueType
internal_repeat_7 1 43 5.7e-5 PROSPERO
Pfam:Collagen 57 112 2e-9 PFAM
low complexity region 126 192 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 231 247 1.5e-10 PROSPERO
internal_repeat_1 232 265 5.16e-11 PROSPERO
Pfam:Collagen 269 331 3.4e-10 PFAM
Pfam:Collagen 360 421 7e-11 PFAM
Pfam:Collagen 430 482 1.9e-7 PFAM
Pfam:Collagen 481 535 7.8e-10 PFAM
Pfam:Collagen 560 623 1.4e-7 PFAM
internal_repeat_9 640 665 9.73e-5 PROSPERO
low complexity region 675 685 N/A INTRINSIC
Pfam:Collagen 686 747 2.5e-11 PFAM
Pfam:Collagen 730 802 5.2e-9 PFAM
Pfam:Collagen 783 860 9.2e-9 PFAM
low complexity region 871 922 N/A INTRINSIC
low complexity region 930 985 N/A INTRINSIC
internal_repeat_2 986 1002 1.5e-10 PROSPERO
internal_repeat_5 990 1038 7.88e-7 PROSPERO
low complexity region 1041 1110 N/A INTRINSIC
Pfam:Collagen 1149 1205 1.8e-10 PFAM
Pfam:Collagen 1203 1260 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVI collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. High levels of type XVI collagen have been found in fibroblasts and keratinocytes, and in smooth muscle and amnion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 E565D probably benign Het
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dnah12 A G 14: 26,697,398 D147G probably benign Het
Dnah12 A T 14: 26,709,257 Y340F probably benign Het
Dot1l G T 10: 80,783,539 R193L probably damaging Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hdc T A 2: 126,597,933 I367F probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mapk1 T A 16: 17,026,429 S22T probably benign Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Papss1 T A 3: 131,583,184 V170D possibly damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pde3a T A 6: 141,250,353 I255N probably damaging Het
Pde3a G T 6: 141,487,513 A757S probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tank T C 2: 61,649,912 F264S probably damaging Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Ubap2 A G 4: 41,221,607 S231P probably benign Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Col16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Col16a1 APN 4 130094552 splice site probably null
IGL00885:Col16a1 APN 4 130096910 missense probably damaging 1.00
IGL01931:Col16a1 APN 4 130072841 missense possibly damaging 0.47
IGL02142:Col16a1 APN 4 130051647 splice site probably null
IGL02307:Col16a1 APN 4 130059009 missense probably damaging 1.00
IGL02731:Col16a1 APN 4 130053530 unclassified probably benign
IGL02742:Col16a1 APN 4 130061379 unclassified probably benign
PIT4520001:Col16a1 UTSW 4 130051663 missense unknown
R0127:Col16a1 UTSW 4 130052857 missense probably damaging 1.00
R0131:Col16a1 UTSW 4 130067096 missense unknown
R0131:Col16a1 UTSW 4 130067096 missense unknown
R0132:Col16a1 UTSW 4 130067096 missense unknown
R0299:Col16a1 UTSW 4 130058318 frame shift probably null
R0355:Col16a1 UTSW 4 130058413 splice site probably benign
R0395:Col16a1 UTSW 4 130073109 missense probably damaging 1.00
R0485:Col16a1 UTSW 4 130090497 splice site probably benign
R0573:Col16a1 UTSW 4 130068475 splice site probably benign
R1274:Col16a1 UTSW 4 130097801 missense probably damaging 0.98
R1619:Col16a1 UTSW 4 130098940 missense probably damaging 1.00
R1759:Col16a1 UTSW 4 130084269 missense probably damaging 1.00
R1832:Col16a1 UTSW 4 130077057 splice site probably null
R1861:Col16a1 UTSW 4 130061724 unclassified probably benign
R1981:Col16a1 UTSW 4 130065443 missense unknown
R2265:Col16a1 UTSW 4 130052918 missense probably benign 0.02
R2269:Col16a1 UTSW 4 130052918 missense probably benign 0.02
R2291:Col16a1 UTSW 4 130067040 missense unknown
R3176:Col16a1 UTSW 4 130057999 missense probably damaging 0.99
R3276:Col16a1 UTSW 4 130057999 missense probably damaging 0.99
R3552:Col16a1 UTSW 4 130077041 missense probably benign 0.10
R4049:Col16a1 UTSW 4 130068752 missense probably damaging 1.00
R4241:Col16a1 UTSW 4 130099050 missense probably damaging 0.98
R4327:Col16a1 UTSW 4 130094551 critical splice donor site probably null
R4591:Col16a1 UTSW 4 130061799 splice site probably null
R4664:Col16a1 UTSW 4 130062090 unclassified probably benign
R4803:Col16a1 UTSW 4 130055108 unclassified probably benign
R4925:Col16a1 UTSW 4 130054176 missense probably damaging 1.00
R4961:Col16a1 UTSW 4 130054479 splice site probably null
R5016:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5027:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5085:Col16a1 UTSW 4 130054171 missense probably damaging 1.00
R5088:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5089:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5408:Col16a1 UTSW 4 130093105 utr 3 prime probably benign
R5472:Col16a1 UTSW 4 130092771 utr 3 prime probably benign
R5564:Col16a1 UTSW 4 130053358 missense probably damaging 1.00
R5597:Col16a1 UTSW 4 130058304 missense probably damaging 1.00
R5703:Col16a1 UTSW 4 130053299 missense probably damaging 0.96
R6054:Col16a1 UTSW 4 130061722 unclassified probably benign
R6226:Col16a1 UTSW 4 130055089 unclassified probably benign
R6362:Col16a1 UTSW 4 130066190 missense unknown
R6448:Col16a1 UTSW 4 130058988 missense probably damaging 1.00
R6449:Col16a1 UTSW 4 130066693 missense unknown
R6502:Col16a1 UTSW 4 130055994 missense probably damaging 1.00
R6949:Col16a1 UTSW 4 130059323 missense probably damaging 1.00
R6969:Col16a1 UTSW 4 130093087 utr 3 prime probably benign
R7086:Col16a1 UTSW 4 130052980 splice site probably null
R7375:Col16a1 UTSW 4 130065501 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCTGGTAGAAGTTCAAGTGTAAGATC -3'
(R):5'- AGGAACAGATGGCATGCCTG -3'

Sequencing Primer
(F):5'- TTTCAGGAGAAAAGAAAGCTAATGC -3'
(R):5'- GCATGCCTGTGCCTGTG -3'
Posted On2014-06-23