Incidental Mutation 'R1862:Pde3a'
ID204022
Institutional Source Beutler Lab
Gene Symbol Pde3a
Ensembl Gene ENSMUSG00000041741
Gene Namephosphodiesterase 3A, cGMP inhibited
SynonymsA930022O17Rik
MMRRC Submission 039885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R1862 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141249269-141507448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 141487513 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 757 (A757S)
Ref Sequence ENSEMBL: ENSMUSP00000038749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043259]
Predicted Effect probably damaging
Transcript: ENSMUST00000043259
AA Change: A757S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: A757S

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 103 121 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
low complexity region 419 445 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
HDc 749 964 3.76e-4 SMART
low complexity region 1028 1056 N/A INTRINSIC
low complexity region 1114 1133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 E565D probably benign Het
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col16a1 G A 4: 130,092,782 probably null Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dnah12 A G 14: 26,697,398 D147G probably benign Het
Dnah12 A T 14: 26,709,257 Y340F probably benign Het
Dot1l G T 10: 80,783,539 R193L probably damaging Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hdc T A 2: 126,597,933 I367F probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mapk1 T A 16: 17,026,429 S22T probably benign Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Papss1 T A 3: 131,583,184 V170D possibly damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tank T C 2: 61,649,912 F264S probably damaging Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Ubap2 A G 4: 41,221,607 S231P probably benign Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Pde3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Pde3a APN 6 141459738 missense probably damaging 1.00
IGL01400:Pde3a APN 6 141459228 missense probably benign 0.02
IGL01752:Pde3a APN 6 141487613 splice site probably benign
IGL01819:Pde3a APN 6 141487537 missense probably damaging 1.00
IGL02014:Pde3a APN 6 141459144 missense probably null 1.00
IGL02119:Pde3a APN 6 141459803 missense probably damaging 0.97
IGL02465:Pde3a APN 6 141249675 missense possibly damaging 0.53
IGL02677:Pde3a APN 6 141405172 splice site probably benign
IGL02961:Pde3a APN 6 141459700 nonsense probably null
IGL03034:Pde3a APN 6 141492400 splice site probably benign
IGL03142:Pde3a APN 6 141492299 missense probably benign 0.01
PIT4305001:Pde3a UTSW 6 141492310 missense probably benign 0.04
R0412:Pde3a UTSW 6 141498684 missense probably damaging 1.00
R0517:Pde3a UTSW 6 141498657 nonsense probably null
R0573:Pde3a UTSW 6 141492231 missense probably damaging 1.00
R0621:Pde3a UTSW 6 141249999 missense probably damaging 1.00
R0781:Pde3a UTSW 6 141459316 splice site probably benign
R1065:Pde3a UTSW 6 141476732 splice site probably benign
R1110:Pde3a UTSW 6 141459316 splice site probably benign
R1462:Pde3a UTSW 6 141459834 missense probably benign 0.05
R1462:Pde3a UTSW 6 141459834 missense probably benign 0.05
R1470:Pde3a UTSW 6 141466206 missense probably benign 0.41
R1470:Pde3a UTSW 6 141466206 missense probably benign 0.41
R1480:Pde3a UTSW 6 141487574 missense probably benign 0.17
R1559:Pde3a UTSW 6 141459098 missense probably damaging 1.00
R1862:Pde3a UTSW 6 141250353 missense probably damaging 1.00
R1902:Pde3a UTSW 6 141498770 missense probably benign
R1909:Pde3a UTSW 6 141250239 missense probably benign 0.00
R2048:Pde3a UTSW 6 141489006 splice site probably benign
R2144:Pde3a UTSW 6 141490111 missense probably benign 0.40
R2155:Pde3a UTSW 6 141483914 missense possibly damaging 0.70
R2208:Pde3a UTSW 6 141250347 missense probably damaging 0.97
R2405:Pde3a UTSW 6 141481242 missense probably damaging 1.00
R4592:Pde3a UTSW 6 141459216 missense probably benign 0.13
R4677:Pde3a UTSW 6 141466139 missense probably benign 0.02
R4803:Pde3a UTSW 6 141459086 missense probably damaging 1.00
R4887:Pde3a UTSW 6 141470942 missense possibly damaging 0.94
R4999:Pde3a UTSW 6 141250025 missense probably benign 0.00
R5055:Pde3a UTSW 6 141487956 nonsense probably null
R5181:Pde3a UTSW 6 141481255 critical splice donor site probably null
R5640:Pde3a UTSW 6 141483915 missense probably damaging 0.99
R5694:Pde3a UTSW 6 141250502 missense possibly damaging 0.48
R6176:Pde3a UTSW 6 141498889 missense possibly damaging 0.96
R6394:Pde3a UTSW 6 141487511 missense probably damaging 1.00
R6692:Pde3a UTSW 6 141479346 missense probably damaging 1.00
R6968:Pde3a UTSW 6 141487932 missense probably damaging 1.00
R7137:Pde3a UTSW 6 141498746 missense probably benign 0.26
R7163:Pde3a UTSW 6 141487544 missense probably damaging 1.00
X0053:Pde3a UTSW 6 141483969 splice site probably null
X0062:Pde3a UTSW 6 141249984 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGTCACTGTAGAAATGATGTGG -3'
(R):5'- CTGTGAAGCTGGGATTACCTG -3'

Sequencing Primer
(F):5'- GGAATTTCCAAAAGTCCCTGTCCTAG -3'
(R):5'- AAGCTGGGATTACCTGACTTG -3'
Posted On2014-06-23