Incidental Mutation 'R1862:Olfr480'
ID204032
Institutional Source Beutler Lab
Gene Symbol Olfr480
Ensembl Gene ENSMUSG00000063120
Gene Nameolfactory receptor 480
SynonymsGA_x6K02T2PBJ9-10395807-10394869, MOR204-32
MMRRC Submission 039885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1862 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108064878-108067346 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 108066725 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 24 (Y24*)
Ref Sequence ENSEMBL: ENSMUSP00000071583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071658] [ENSMUST00000217653]
Predicted Effect probably null
Transcript: ENSMUST00000071658
AA Change: Y24*
SMART Domains Protein: ENSMUSP00000071583
Gene: ENSMUSG00000063120
AA Change: Y24*

DomainStartEndE-ValueType
Pfam:7tm_4 61 338 1.7e-50 PFAM
Pfam:7tm_1 71 320 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217653
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 E565D probably benign Het
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col16a1 G A 4: 130,092,782 probably null Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dnah12 A G 14: 26,697,398 D147G probably benign Het
Dnah12 A T 14: 26,709,257 Y340F probably benign Het
Dot1l G T 10: 80,783,539 R193L probably damaging Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hdc T A 2: 126,597,933 I367F probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mapk1 T A 16: 17,026,429 S22T probably benign Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Papss1 T A 3: 131,583,184 V170D possibly damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pde3a T A 6: 141,250,353 I255N probably damaging Het
Pde3a G T 6: 141,487,513 A757S probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tank T C 2: 61,649,912 F264S probably damaging Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Ubap2 A G 4: 41,221,607 S231P probably benign Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Olfr480
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Olfr480 APN 7 108066288 missense probably benign 0.32
IGL02060:Olfr480 APN 7 108066671 missense probably benign 0.03
IGL02392:Olfr480 APN 7 108066503 missense probably benign 0.10
IGL02493:Olfr480 APN 7 108065805 missense possibly damaging 0.79
IGL02634:Olfr480 APN 7 108066771 missense probably benign 0.00
F5770:Olfr480 UTSW 7 108066678 missense probably benign 0.11
R0446:Olfr480 UTSW 7 108066725 nonsense probably null
R1070:Olfr480 UTSW 7 108066651 missense probably benign 0.00
R1510:Olfr480 UTSW 7 108066528 missense probably damaging 1.00
R1863:Olfr480 UTSW 7 108066725 nonsense probably null
R1885:Olfr480 UTSW 7 108066778 missense probably benign 0.00
R1886:Olfr480 UTSW 7 108066778 missense probably benign 0.00
R1887:Olfr480 UTSW 7 108066778 missense probably benign 0.00
R3609:Olfr480 UTSW 7 108066369 missense probably damaging 1.00
R3921:Olfr480 UTSW 7 108065901 missense possibly damaging 0.94
R4259:Olfr480 UTSW 7 108065893 nonsense probably null
R5276:Olfr480 UTSW 7 108066216 nonsense probably null
R6224:Olfr480 UTSW 7 108066742 missense probably benign 0.00
V7581:Olfr480 UTSW 7 108066678 missense probably benign 0.11
X0021:Olfr480 UTSW 7 108066588 missense probably benign 0.01
X0066:Olfr480 UTSW 7 108066435 missense probably benign 0.00
Z1088:Olfr480 UTSW 7 108066327 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGCTGGTTCTGATTAGCAC -3'
(R):5'- TCAGTAGATCTCTATTGCTCACTG -3'

Sequencing Primer
(F):5'- GCTGGTTCTGATTAGCACAATTATG -3'
(R):5'- TGCTCACTGAAATATAAACTAGCAAC -3'
Posted On2014-06-23