Incidental Mutation 'R1862:Dot1l'
ID204048
Institutional Source Beutler Lab
Gene Symbol Dot1l
Ensembl Gene ENSMUSG00000061589
Gene NameDOT1-like, histone H3 methyltransferase (S. cerevisiae)
SynonymsmDot1, KMT4
MMRRC Submission 039885-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1862 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80755206-80795461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80783539 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 193 (R193L)
Ref Sequence ENSEMBL: ENSMUSP00000116581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105336] [ENSMUST00000127740] [ENSMUST00000150338]
Predicted Effect probably damaging
Transcript: ENSMUST00000105336
AA Change: R410L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100973
Gene: ENSMUSG00000061589
AA Change: R410L

DomainStartEndE-ValueType
Pfam:DOT1 115 317 9.4e-86 PFAM
low complexity region 335 348 N/A INTRINSIC
AT_hook 407 419 4.64e-1 SMART
low complexity region 437 447 N/A INTRINSIC
coiled coil region 558 647 N/A INTRINSIC
low complexity region 917 936 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1084 1095 N/A INTRINSIC
low complexity region 1145 1157 N/A INTRINSIC
low complexity region 1186 1198 N/A INTRINSIC
low complexity region 1436 1446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127740
Predicted Effect probably damaging
Transcript: ENSMUST00000150338
AA Change: R193L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116581
Gene: ENSMUSG00000061589
AA Change: R193L

DomainStartEndE-ValueType
Pfam:DOT1 1 100 3.4e-37 PFAM
low complexity region 118 131 N/A INTRINSIC
AT_hook 190 202 4.64e-1 SMART
low complexity region 220 230 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
SCOP:d1fxkc_ 396 441 1e-3 SMART
low complexity region 700 719 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 969 981 N/A INTRINSIC
low complexity region 1020 1032 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
low complexity region 1060 1105 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163526
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates lysine-79 of histone H3. It is inactive against free core histones, but shows significant histone methyltransferase activity against nucleosomes. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele show late embryonic lethality. Mice homozygous for a null allele die by E10.5 displaying a growth arrest, abnormal yolk sac angiogenesis and heart dilation while mutant ES cells show elevated apoptosis, G2 cell cycle arrest, telomere elongation and aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 E565D probably benign Het
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col16a1 G A 4: 130,092,782 probably null Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dnah12 A G 14: 26,697,398 D147G probably benign Het
Dnah12 A T 14: 26,709,257 Y340F probably benign Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hdc T A 2: 126,597,933 I367F probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mapk1 T A 16: 17,026,429 S22T probably benign Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Papss1 T A 3: 131,583,184 V170D possibly damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pde3a T A 6: 141,250,353 I255N probably damaging Het
Pde3a G T 6: 141,487,513 A757S probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tank T C 2: 61,649,912 F264S probably damaging Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Ubap2 A G 4: 41,221,607 S231P probably benign Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Dot1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01836:Dot1l APN 10 80785866 missense probably benign 0.00
IGL01915:Dot1l APN 10 80780894 missense probably damaging 0.99
IGL02287:Dot1l APN 10 80764609 missense possibly damaging 0.66
IGL02695:Dot1l APN 10 80777608 missense probably damaging 1.00
IGL03058:Dot1l APN 10 80790997 missense probably benign 0.00
IGL03071:Dot1l APN 10 80788679 missense probably benign 0.00
IGL03120:Dot1l APN 10 80786273 splice site probably benign
R0220:Dot1l UTSW 10 80785858 missense probably damaging 0.99
R1342:Dot1l UTSW 10 80786025 missense probably benign 0.14
R1701:Dot1l UTSW 10 80790742 missense possibly damaging 0.93
R2094:Dot1l UTSW 10 80785878 missense probably damaging 1.00
R2308:Dot1l UTSW 10 80789069 missense probably damaging 1.00
R4274:Dot1l UTSW 10 80783988 critical splice donor site probably null
R4617:Dot1l UTSW 10 80785084 missense probably damaging 0.97
R4623:Dot1l UTSW 10 80782150 missense probably benign 0.18
R4690:Dot1l UTSW 10 80786182 nonsense probably null
R5009:Dot1l UTSW 10 80771196 missense probably benign 0.25
R5072:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5073:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5074:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5305:Dot1l UTSW 10 80790793 missense probably benign 0.03
R5312:Dot1l UTSW 10 80784637 missense possibly damaging 0.94
R5512:Dot1l UTSW 10 80788991 missense possibly damaging 0.92
R5551:Dot1l UTSW 10 80783628 small deletion probably benign
R5552:Dot1l UTSW 10 80783628 small deletion probably benign
R5553:Dot1l UTSW 10 80783628 small deletion probably benign
R6056:Dot1l UTSW 10 80786095 missense probably damaging 0.96
R6207:Dot1l UTSW 10 80786443 missense probably benign 0.06
R6419:Dot1l UTSW 10 80791481 missense possibly damaging 0.85
R6782:Dot1l UTSW 10 80789390 missense probably damaging 1.00
R7054:Dot1l UTSW 10 80787023 missense probably damaging 0.99
R7071:Dot1l UTSW 10 80792245 missense probably benign 0.01
R7097:Dot1l UTSW 10 80790726 missense probably damaging 0.98
R7131:Dot1l UTSW 10 80792341 missense unknown
R7459:Dot1l UTSW 10 80773173 missense probably damaging 0.96
X0066:Dot1l UTSW 10 80788683 missense possibly damaging 0.94
X0066:Dot1l UTSW 10 80788684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGCCTATGGTCTTGTGAG -3'
(R):5'- ACTGAGCTCCTCCTGGTTTG -3'

Sequencing Primer
(F):5'- GGTCTTGTGAGCACTCCTGC -3'
(R):5'- TGGCAGAGTCCCATAGTCACATG -3'
Posted On2014-06-23