Incidental Mutation 'R1862:Mprip'
ID204050
Institutional Source Beutler Lab
Gene Symbol Mprip
Ensembl Gene ENSMUSG00000005417
Gene Namemyosin phosphatase Rho interacting protein
Synonymsp116Rip, Rhoip3, RIP3, p116 Rho interacting protein
MMRRC Submission 039885-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R1862 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location59661305-59780860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59758221 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 917 (T917M)
Ref Sequence ENSEMBL: ENSMUSP00000071081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066330] [ENSMUST00000072031] [ENSMUST00000108751] [ENSMUST00000116371] [ENSMUST00000133861]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066330
AA Change: T917M

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071081
Gene: ENSMUSG00000005417
AA Change: T917M

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 249 320 1e-10 BLAST
PH 351 448 3.76e-18 SMART
low complexity region 492 501 N/A INTRINSIC
low complexity region 536 555 N/A INTRINSIC
coiled coil region 636 671 N/A INTRINSIC
Blast:PAC 806 848 2e-10 BLAST
low complexity region 1005 1023 N/A INTRINSIC
low complexity region 1047 1059 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1183 1200 N/A INTRINSIC
coiled coil region 1267 1300 N/A INTRINSIC
coiled coil region 1617 1642 N/A INTRINSIC
coiled coil region 1729 1779 N/A INTRINSIC
coiled coil region 1899 1936 N/A INTRINSIC
coiled coil region 1960 2110 N/A INTRINSIC
coiled coil region 2132 2206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072031
SMART Domains Protein: ENSMUSP00000071914
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108751
SMART Domains Protein: ENSMUSP00000104382
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 183 196 N/A INTRINSIC
Blast:PH 216 282 1e-10 BLAST
PH 349 446 3.76e-18 SMART
low complexity region 490 499 N/A INTRINSIC
low complexity region 534 553 N/A INTRINSIC
coiled coil region 634 669 N/A INTRINSIC
coiled coil region 690 840 N/A INTRINSIC
coiled coil region 862 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116371
SMART Domains Protein: ENSMUSP00000112072
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132620
SMART Domains Protein: ENSMUSP00000119422
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Blast:PH 101 167 9e-11 BLAST
PH 198 295 3.76e-18 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 383 402 N/A INTRINSIC
coiled coil region 482 517 N/A INTRINSIC
coiled coil region 538 688 N/A INTRINSIC
coiled coil region 710 784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133861
SMART Domains Protein: ENSMUSP00000119562
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
PH 373 470 3.76e-18 SMART
low complexity region 514 523 N/A INTRINSIC
low complexity region 558 577 N/A INTRINSIC
coiled coil region 658 693 N/A INTRINSIC
coiled coil region 714 864 N/A INTRINSIC
coiled coil region 886 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156111
SMART Domains Protein: ENSMUSP00000114446
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
internal_repeat_1 5 38 1.61e-7 PROSPERO
internal_repeat_2 9 51 2.4e-6 PROSPERO
internal_repeat_1 59 92 1.61e-7 PROSPERO
internal_repeat_2 85 129 2.4e-6 PROSPERO
coiled coil region 140 177 N/A INTRINSIC
coiled coil region 201 351 N/A INTRINSIC
coiled coil region 373 447 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 E565D probably benign Het
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col16a1 G A 4: 130,092,782 probably null Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dnah12 A G 14: 26,697,398 D147G probably benign Het
Dnah12 A T 14: 26,709,257 Y340F probably benign Het
Dot1l G T 10: 80,783,539 R193L probably damaging Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hdc T A 2: 126,597,933 I367F probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mapk1 T A 16: 17,026,429 S22T probably benign Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Papss1 T A 3: 131,583,184 V170D possibly damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pde3a T A 6: 141,250,353 I255N probably damaging Het
Pde3a G T 6: 141,487,513 A757S probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tank T C 2: 61,649,912 F264S probably damaging Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Ubap2 A G 4: 41,221,607 S231P probably benign Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Mprip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mprip APN 11 59748591 missense probably benign 0.07
IGL00563:Mprip APN 11 59752617 missense probably damaging 1.00
IGL00905:Mprip APN 11 59772168 missense possibly damaging 0.79
IGL00928:Mprip APN 11 59744752 missense probably damaging 1.00
IGL01161:Mprip APN 11 59731573 missense possibly damaging 0.93
IGL01991:Mprip APN 11 59755012 missense probably damaging 0.99
IGL02491:Mprip APN 11 59770031 missense probably benign 0.13
IGL03030:Mprip APN 11 59741115 splice site probably null
IGL03056:Mprip APN 11 59771692 missense probably damaging 1.00
IGL03293:Mprip APN 11 59696163 missense probably damaging 1.00
R0049:Mprip UTSW 11 59766745 missense probably damaging 0.99
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0147:Mprip UTSW 11 59737073 missense possibly damaging 0.68
R0319:Mprip UTSW 11 59697038 splice site probably benign
R0471:Mprip UTSW 11 59759735 missense probably damaging 1.00
R0539:Mprip UTSW 11 59741117 splice site probably benign
R0627:Mprip UTSW 11 59769972 missense probably damaging 1.00
R0864:Mprip UTSW 11 59758761 missense probably benign
R1218:Mprip UTSW 11 59743814 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1695:Mprip UTSW 11 59752531 missense probably damaging 0.99
R1698:Mprip UTSW 11 59760258 missense possibly damaging 0.75
R1802:Mprip UTSW 11 59755041 missense probably damaging 1.00
R1837:Mprip UTSW 11 59766745 missense probably damaging 0.99
R2094:Mprip UTSW 11 59749508 splice site probably benign
R2107:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2108:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2510:Mprip UTSW 11 59749508 splice site probably benign
R3003:Mprip UTSW 11 59727555 missense possibly damaging 0.95
R3115:Mprip UTSW 11 59765403 splice site probably null
R3941:Mprip UTSW 11 59731502 splice site probably benign
R4347:Mprip UTSW 11 59759453 missense possibly damaging 0.86
R4603:Mprip UTSW 11 59731573 missense probably damaging 1.00
R4807:Mprip UTSW 11 59758020 missense probably benign 0.00
R5011:Mprip UTSW 11 59759895 missense possibly damaging 0.75
R5338:Mprip UTSW 11 59760573 missense probably damaging 1.00
R5549:Mprip UTSW 11 59760818 missense probably benign 0.00
R5569:Mprip UTSW 11 59760963 missense probably damaging 1.00
R5604:Mprip UTSW 11 59758467 missense probably benign
R5615:Mprip UTSW 11 59758487 missense probably benign 0.08
R5846:Mprip UTSW 11 59758554 missense probably damaging 1.00
R5970:Mprip UTSW 11 59757721 missense probably damaging 0.96
R6054:Mprip UTSW 11 59758425 missense probably benign
R6452:Mprip UTSW 11 59752783 missense probably damaging 1.00
R6457:Mprip UTSW 11 59758989 missense possibly damaging 0.69
R6544:Mprip UTSW 11 59757726 missense probably benign 0.15
R6750:Mprip UTSW 11 59696131 missense probably damaging 1.00
R6843:Mprip UTSW 11 59759728 missense possibly damaging 0.54
R6851:Mprip UTSW 11 59759015 missense probably damaging 0.99
R6867:Mprip UTSW 11 59749630 critical splice donor site probably null
R7002:Mprip UTSW 11 59761190 missense probably benign 0.22
R7023:Mprip UTSW 11 59737389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATGCATTGCTGAGCTCAG -3'
(R):5'- CAGCTTCTCTTGGAGCTCAG -3'

Sequencing Primer
(F):5'- GTACCAGTGAGCAAGCCCAG -3'
(R):5'- TTGGAGCTCAGCCACATCC -3'
Posted On2014-06-23