Incidental Mutation 'R1862:Mapk1'
ID204067
Institutional Source Beutler Lab
Gene Symbol Mapk1
Ensembl Gene ENSMUSG00000063358
Gene Namemitogen-activated protein kinase 1
SynonymsPrkm1, p42mapk, 9030612K14Rik, MAPK2, Erk2
MMRRC Submission 039885-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1862 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16983382-17047453 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17026429 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 22 (S22T)
Ref Sequence ENSEMBL: ENSMUSP00000156214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023462] [ENSMUST00000069107] [ENSMUST00000115731] [ENSMUST00000129477] [ENSMUST00000232067] [ENSMUST00000232611]
Predicted Effect probably benign
Transcript: ENSMUST00000023462
AA Change: S264T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023462
Gene: ENSMUSG00000063358
AA Change: S264T

DomainStartEndE-ValueType
S_TKc 23 311 1.06e-95 SMART
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069107
AA Change: S264T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000065983
Gene: ENSMUSG00000063358
AA Change: S264T

DomainStartEndE-ValueType
S_TKc 23 311 1.06e-95 SMART
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115731
AA Change: S264T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000111396
Gene: ENSMUSG00000063358
AA Change: S264T

DomainStartEndE-ValueType
S_TKc 23 311 1.06e-95 SMART
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129477
AA Change: S22T

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115125
Gene: ENSMUSG00000063358
AA Change: S22T

DomainStartEndE-ValueType
Pfam:Pkinase 2 69 1.3e-5 PFAM
low complexity region 106 120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231420
Predicted Effect probably benign
Transcript: ENSMUST00000231821
Predicted Effect probably benign
Transcript: ENSMUST00000232067
AA Change: S22T

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232281
Predicted Effect probably benign
Transcript: ENSMUST00000232611
AA Change: S264T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The activation of this kinase requires its phosphorylation by upstream kinases. Upon activation, this kinase translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. One study also suggests that this protein acts as a transcriptional repressor independent of its kinase activity. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Two alternatively spliced transcript variants encoding the same protein, but differing in the UTRs, have been reported for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutant embryos implant in the uterus, but die shortly thereafter failing to form extraembryonic tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 E565D probably benign Het
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col16a1 G A 4: 130,092,782 probably null Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dnah12 A G 14: 26,697,398 D147G probably benign Het
Dnah12 A T 14: 26,709,257 Y340F probably benign Het
Dot1l G T 10: 80,783,539 R193L probably damaging Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hdc T A 2: 126,597,933 I367F probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Papss1 T A 3: 131,583,184 V170D possibly damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pde3a T A 6: 141,250,353 I255N probably damaging Het
Pde3a G T 6: 141,487,513 A757S probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tank T C 2: 61,649,912 F264S probably damaging Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Ubap2 A G 4: 41,221,607 S231P probably benign Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Mapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Mapk1 APN 16 17035458 missense probably benign 0.00
IGL01486:Mapk1 APN 16 17018280 splice site probably benign
IGL01764:Mapk1 APN 16 16983733 missense possibly damaging 0.50
IGL02138:Mapk1 APN 16 17023452 missense probably benign 0.18
IGL02701:Mapk1 APN 16 17015906 missense probably benign 0.00
R0517:Mapk1 UTSW 16 17016046 missense probably benign 0.02
R1609:Mapk1 UTSW 16 17038306 splice site probably benign
R2885:Mapk1 UTSW 16 17026445 missense probably benign
R4205:Mapk1 UTSW 16 17038457 intron probably benign
R4959:Mapk1 UTSW 16 17018306 missense probably damaging 1.00
R5694:Mapk1 UTSW 16 17018469 missense probably benign 0.02
R6630:Mapk1 UTSW 16 17026385 missense probably damaging 1.00
R6809:Mapk1 UTSW 16 17035462 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGCTCACTCTAGCATGGTTG -3'
(R):5'- TGAACCAGCTTTCCAGTCTAAC -3'

Sequencing Primer
(F):5'- TGCTTTGTTTTGTTTTCATGTTCTC -3'
(R):5'- TTTTCAAGCTGGAGCCTG -3'
Posted On2014-06-23