Incidental Mutation 'R0110:Dnah12'
ID20409
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission 038396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R0110 (G1)
Quality Score88
Status Validated (trace)
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26798899 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1892 (R1892G)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect probably damaging
Transcript: ENSMUST00000022433
AA Change: R1892G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: R1892G

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency 98% (105/107)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,506 probably benign Het
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arpc1b T A 5: 145,127,715 W361R probably damaging Het
Baiap2l1 T C 5: 144,275,891 Y438C probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cntln C T 4: 85,096,757 T1095I probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dock4 A G 12: 40,621,312 probably benign Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Fam227b T A 2: 126,100,921 S319C probably damaging Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Gal3st2c C T 1: 94,009,497 P388L probably benign Het
Ggn C T 7: 29,171,296 P47S probably damaging Het
Gli3 T G 13: 15,724,785 L919R probably damaging Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 C A 1: 44,059,224 V905F probably benign Het
Gmip C T 8: 69,815,609 probably benign Het
Gpr39 C T 1: 125,677,500 T55M probably damaging Het
Grk4 A G 5: 34,716,213 T208A probably damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hadhb T C 5: 30,169,485 probably benign Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpa A T 2: 130,679,418 probably benign Het
Klhl10 A G 11: 100,456,932 T605A probably benign Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lap3 T C 5: 45,495,290 probably benign Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map3k6 T C 4: 133,243,794 L273P probably damaging Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mrc1 T A 2: 14,238,542 probably benign Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtcl1 C T 17: 66,358,114 E1149K possibly damaging Het
Naca C T 10: 128,044,790 A1897V probably benign Het
Ncapg T C 5: 45,693,147 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pla2g4a T A 1: 149,840,647 M688L possibly damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Prmt1 A G 7: 44,978,801 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Prom2 T G 2: 127,531,113 S679R possibly damaging Het
Psen2 T C 1: 180,238,914 T153A probably damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Stam2 A T 2: 52,719,986 probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Tas2r123 T C 6: 132,847,332 V64A probably benign Het
Tnnc1 A G 14: 31,211,408 D149G probably damaging Het
Tpp2 A G 1: 43,999,693 D1133G probably damaging Het
Tpp2 T A 1: 43,978,504 V756E probably benign Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Tsen15 A G 1: 152,371,797 V148A probably damaging Het
Ttn T A 2: 76,864,328 probably benign Het
Ube2u A G 4: 100,486,673 I90V probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Wdr41 T C 13: 95,018,111 probably benign Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp423 A G 8: 87,782,259 S486P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26799076 intron probably null
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7108:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7121:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7122:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26801413 missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26861732 missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26814413 missense probably benign 0.04
R7201:Dnah12 UTSW 14 26814622 missense probably benign 0.08
R7202:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26781485 missense probably damaging 0.99
R7205:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7206:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7219:Dnah12 UTSW 14 26854880 missense probably damaging 0.99
R7339:Dnah12 UTSW 14 26872320 missense probably benign
R7363:Dnah12 UTSW 14 26724611 missense probably benign
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTGTGAGTGTACGGCCTCTCCATC -3'
(R):5'- GCTCCCAGACATTGTCTCAGTTACC -3'

Sequencing Primer
(F):5'- cgtgcttttgctctttaccc -3'
(R):5'- GACATTGTCTCAGTTACCTGAAACTC -3'
Posted On2013-04-11