Incidental Mutation 'R1863:Eps8l1'
ID204111
Institutional Source Beutler Lab
Gene Symbol Eps8l1
Ensembl Gene ENSMUSG00000006154
Gene NameEPS8-like 1
Synonyms4632407K17Rik, 2310051G19Rik, DRC3, EPS8R1
MMRRC Submission 039886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1863 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4460674-4480487 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) C to A at 4465360 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086372] [ENSMUST00000163137] [ENSMUST00000163804] [ENSMUST00000163893] [ENSMUST00000167298] [ENSMUST00000167810] [ENSMUST00000169820] [ENSMUST00000170635] [ENSMUST00000171445]
Predicted Effect probably benign
Transcript: ENSMUST00000086372
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146199
Predicted Effect probably benign
Transcript: ENSMUST00000163137
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163804
Predicted Effect probably benign
Transcript: ENSMUST00000163893
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167599
Predicted Effect probably benign
Transcript: ENSMUST00000167810
SMART Domains Protein: ENSMUSP00000126720
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 152 5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169820
SMART Domains Protein: ENSMUSP00000131773
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 93 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170423
Predicted Effect probably benign
Transcript: ENSMUST00000170635
SMART Domains Protein: ENSMUSP00000127999
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
PDB:2CY5|A 26 52 3e-13 PDB
Predicted Effect unknown
Transcript: ENSMUST00000171445
AA Change: H50N
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154
AA Change: H50N

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171665
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.0%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. At least two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,593 I2108V probably benign Het
A2ml1 A T 6: 128,550,783 S1015T probably damaging Het
Adamts10 T A 17: 33,551,432 probably null Het
Adgrv1 G A 13: 81,563,566 T1097I probably damaging Het
Apeh T C 9: 108,092,103 Y274C possibly damaging Het
Apobec3 A G 15: 79,897,867 D26G possibly damaging Het
Arg2 C T 12: 79,150,020 Q172* probably null Het
Asb18 C T 1: 90,014,382 V66I probably benign Het
Cacna1i G A 15: 80,358,931 G430S probably damaging Het
Cadps A G 14: 12,449,802 S1136P possibly damaging Het
Cadps A G 14: 12,505,796 V758A probably benign Het
Calhm3 A G 19: 47,152,100 W185R probably damaging Het
Car5b T C X: 163,991,373 D146G probably damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cd300lg T G 11: 102,041,604 V5G probably damaging Het
Cd46 C A 1: 195,083,623 G145C probably damaging Het
Chit1 T C 1: 134,151,250 S433P probably damaging Het
Cntrl G A 2: 35,118,119 E182K possibly damaging Het
Col6a5 T A 9: 105,940,201 M304L unknown Het
Cpxm2 C T 7: 132,143,663 probably null Het
Dbf4 G A 5: 8,397,375 Q612* probably null Het
Dnah11 G C 12: 118,063,852 Q1835E possibly damaging Het
Ehbp1l1 A T 19: 5,717,854 N1140K probably benign Het
Fbxl21 A T 13: 56,527,063 I76L probably benign Het
Gcnt2 A T 13: 40,861,101 K249N possibly damaging Het
Gm11487 A T 4: 73,401,800 Y247* probably null Het
Gm5819 A G 18: 8,694,179 T35A probably benign Het
Gm8180 T C 14: 43,783,682 E23G probably benign Het
Gorab A G 1: 163,403,562 F8L probably damaging Het
Hlf A G 11: 90,340,826 L274S probably damaging Het
Il15ra T A 2: 11,723,436 S137T possibly damaging Het
Krt78 A T 15: 101,946,569 C936S possibly damaging Het
Lamb2 T C 9: 108,481,384 S207P probably benign Het
Lce1a1 T C 3: 92,646,811 S119G unknown Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrp4 T A 2: 91,498,363 L1536Q probably benign Het
Lrrc25 T C 8: 70,617,946 S126P possibly damaging Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mss51 C T 14: 20,484,868 R278H probably damaging Het
Myom3 G A 4: 135,778,037 M412I probably benign Het
Naa25 T C 5: 121,435,548 V780A probably benign Het
Naip6 A T 13: 100,300,559 F485L probably benign Het
Notch1 T C 2: 26,469,950 Y1251C probably damaging Het
Npas3 A G 12: 54,068,826 N826D probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1247 A T 2: 89,609,709 L131* probably null Het
Olfr1260 A T 2: 89,978,410 I211F probably benign Het
Olfr143 T G 9: 38,253,720 M101R probably damaging Het
Olfr285 G T 15: 98,313,491 Q20K probably benign Het
Olfr328 T C 11: 58,552,023 Y72C probably benign Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr798 T C 10: 129,625,348 T238A probably damaging Het
Osbpl6 G A 2: 76,585,058 R588H probably damaging Het
Pcdhb17 A T 18: 37,486,111 D318V probably benign Het
Pcnx2 T A 8: 125,818,786 E1162V probably damaging Het
Pde2a G A 7: 101,511,154 R845H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Ppl T C 16: 5,087,980 K1484E possibly damaging Het
Pramel7 T C 2: 87,491,331 E120G probably benign Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Prpf6 T A 2: 181,608,174 D42E possibly damaging Het
Rbm5 C T 9: 107,750,519 V408I possibly damaging Het
Rsrp1 G T 4: 134,924,077 D51Y unknown Het
Sec22a A G 16: 35,347,718 M141T probably damaging Het
Spryd3 A G 15: 102,117,659 S417P probably benign Het
Sptbn2 A G 19: 4,732,685 M550V possibly damaging Het
Sugt1 C T 14: 79,608,994 T157I probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tas2r122 A T 6: 132,711,102 L276* probably null Het
Tbc1d14 G A 5: 36,507,693 S231F probably damaging Het
Tenm3 T A 8: 48,276,346 I1526F probably benign Het
Tgm2 C T 2: 158,124,219 C505Y probably damaging Het
Thop1 T C 10: 81,073,317 Y61H probably damaging Het
Ticam1 G A 17: 56,271,436 H220Y probably damaging Het
Tle6 T C 10: 81,591,921 D500G possibly damaging Het
Tm6sf2 T A 8: 70,079,725 L345Q probably damaging Het
Tnxb T C 17: 34,670,874 C114R probably damaging Het
Topors G T 4: 40,262,149 C378* probably null Het
Ttc6 G A 12: 57,714,095 G1544R probably benign Het
Vmn2r4 A T 3: 64,406,989 N190K probably benign Het
Wdr70 C A 15: 7,920,573 V447F probably benign Het
Xpa A G 4: 46,155,730 probably benign Het
Xrcc1 T C 7: 24,570,575 S474P possibly damaging Het
Zfp658 T G 7: 43,573,899 F533V possibly damaging Het
Zfp799 G A 17: 32,819,400 H631Y probably damaging Het
Other mutations in Eps8l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Eps8l1 APN 7 4478920 utr 3 prime probably benign
IGL01455:Eps8l1 APN 7 4478923 utr 3 prime probably benign
IGL01872:Eps8l1 APN 7 4472296 splice site probably benign
IGL02343:Eps8l1 APN 7 4472124 missense probably benign 0.04
IGL02585:Eps8l1 APN 7 4469213 missense probably damaging 1.00
IGL02596:Eps8l1 APN 7 4470872 missense probably damaging 0.99
IGL02673:Eps8l1 APN 7 4478732 missense probably damaging 1.00
IGL03117:Eps8l1 APN 7 4470887 missense probably damaging 1.00
anamnestic UTSW 7 4470874 missense probably damaging 0.98
souvenir UTSW 7 4477896 missense possibly damaging 0.56
PIT4142001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4151001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4480001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
R0015:Eps8l1 UTSW 7 4477557 splice site probably benign
R0599:Eps8l1 UTSW 7 4477957 missense possibly damaging 0.90
R0686:Eps8l1 UTSW 7 4477450 missense probably benign 0.36
R0827:Eps8l1 UTSW 7 4477389 missense possibly damaging 0.86
R1015:Eps8l1 UTSW 7 4469933 missense probably damaging 1.00
R1447:Eps8l1 UTSW 7 4474056 missense probably damaging 1.00
R1490:Eps8l1 UTSW 7 4470889 missense probably damaging 1.00
R1527:Eps8l1 UTSW 7 4471394 missense probably benign
R1553:Eps8l1 UTSW 7 4477449 missense probably damaging 0.98
R1763:Eps8l1 UTSW 7 4471823 missense probably benign 0.43
R2357:Eps8l1 UTSW 7 4470355 missense probably benign 0.06
R3153:Eps8l1 UTSW 7 4471799 missense probably damaging 1.00
R4082:Eps8l1 UTSW 7 4470798 splice site probably null
R4539:Eps8l1 UTSW 7 4478624 missense probably damaging 1.00
R4684:Eps8l1 UTSW 7 4473945 missense probably damaging 0.99
R4930:Eps8l1 UTSW 7 4460916 missense possibly damaging 0.66
R4931:Eps8l1 UTSW 7 4471241 missense possibly damaging 0.95
R5245:Eps8l1 UTSW 7 4470874 missense probably damaging 0.98
R5247:Eps8l1 UTSW 7 4470402 missense probably damaging 1.00
R5305:Eps8l1 UTSW 7 4477896 missense possibly damaging 0.56
R5420:Eps8l1 UTSW 7 4470161 intron probably null
R5620:Eps8l1 UTSW 7 4460946 missense possibly damaging 0.83
R5705:Eps8l1 UTSW 7 4470035 missense probably benign 0.00
R6063:Eps8l1 UTSW 7 4471297 missense possibly damaging 0.56
R6909:Eps8l1 UTSW 7 4469900 nonsense probably null
R7096:Eps8l1 UTSW 7 4474191 missense probably benign 0.01
R7136:Eps8l1 UTSW 7 4477404 missense probably damaging 1.00
R7144:Eps8l1 UTSW 7 4472185 missense probably damaging 1.00
R7539:Eps8l1 UTSW 7 4470037 missense probably damaging 1.00
X0060:Eps8l1 UTSW 7 4470851 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATCGGGACTTCAGTGTCTG -3'
(R):5'- TTCTATCAATGCCTAACCACAGG -3'

Sequencing Primer
(F):5'- AGGACAGCTGGGTTCTGGAC -3'
(R):5'- TAACCACAGGCTGGGCAG -3'
Posted On2014-06-23