Incidental Mutation 'R1863:Tenm3'
ID204118
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Nameteneurin transmembrane protein 3
SynonymsTen-m3, Odz3, 2610100B16Rik
MMRRC Submission 039886-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.622) question?
Stock #R1863 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location48227682-48843951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48276346 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1526 (I1526F)
Ref Sequence ENSEMBL: ENSMUSP00000140141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]
Predicted Effect probably benign
Transcript: ENSMUST00000033965
AA Change: I1542F

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: I1542F

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145344
Predicted Effect probably benign
Transcript: ENSMUST00000190840
AA Change: I1526F

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: I1526F

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.0%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,593 I2108V probably benign Het
A2ml1 A T 6: 128,550,783 S1015T probably damaging Het
Adamts10 T A 17: 33,551,432 probably null Het
Adgrv1 G A 13: 81,563,566 T1097I probably damaging Het
Apeh T C 9: 108,092,103 Y274C possibly damaging Het
Apobec3 A G 15: 79,897,867 D26G possibly damaging Het
Arg2 C T 12: 79,150,020 Q172* probably null Het
Asb18 C T 1: 90,014,382 V66I probably benign Het
Cacna1i G A 15: 80,358,931 G430S probably damaging Het
Cadps A G 14: 12,449,802 S1136P possibly damaging Het
Cadps A G 14: 12,505,796 V758A probably benign Het
Calhm3 A G 19: 47,152,100 W185R probably damaging Het
Car5b T C X: 163,991,373 D146G probably damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cd300lg T G 11: 102,041,604 V5G probably damaging Het
Cd46 C A 1: 195,083,623 G145C probably damaging Het
Chit1 T C 1: 134,151,250 S433P probably damaging Het
Cntrl G A 2: 35,118,119 E182K possibly damaging Het
Col6a5 T A 9: 105,940,201 M304L unknown Het
Cpxm2 C T 7: 132,143,663 probably null Het
Dbf4 G A 5: 8,397,375 Q612* probably null Het
Dnah11 G C 12: 118,063,852 Q1835E possibly damaging Het
Ehbp1l1 A T 19: 5,717,854 N1140K probably benign Het
Eps8l1 C A 7: 4,465,360 probably benign Het
Fbxl21 A T 13: 56,527,063 I76L probably benign Het
Gcnt2 A T 13: 40,861,101 K249N possibly damaging Het
Gm11487 A T 4: 73,401,800 Y247* probably null Het
Gm5819 A G 18: 8,694,179 T35A probably benign Het
Gm8180 T C 14: 43,783,682 E23G probably benign Het
Gorab A G 1: 163,403,562 F8L probably damaging Het
Hlf A G 11: 90,340,826 L274S probably damaging Het
Il15ra T A 2: 11,723,436 S137T possibly damaging Het
Krt78 A T 15: 101,946,569 C936S possibly damaging Het
Lamb2 T C 9: 108,481,384 S207P probably benign Het
Lce1a1 T C 3: 92,646,811 S119G unknown Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrp4 T A 2: 91,498,363 L1536Q probably benign Het
Lrrc25 T C 8: 70,617,946 S126P possibly damaging Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mss51 C T 14: 20,484,868 R278H probably damaging Het
Myom3 G A 4: 135,778,037 M412I probably benign Het
Naa25 T C 5: 121,435,548 V780A probably benign Het
Naip6 A T 13: 100,300,559 F485L probably benign Het
Notch1 T C 2: 26,469,950 Y1251C probably damaging Het
Npas3 A G 12: 54,068,826 N826D probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1247 A T 2: 89,609,709 L131* probably null Het
Olfr1260 A T 2: 89,978,410 I211F probably benign Het
Olfr143 T G 9: 38,253,720 M101R probably damaging Het
Olfr285 G T 15: 98,313,491 Q20K probably benign Het
Olfr328 T C 11: 58,552,023 Y72C probably benign Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr798 T C 10: 129,625,348 T238A probably damaging Het
Osbpl6 G A 2: 76,585,058 R588H probably damaging Het
Pcdhb17 A T 18: 37,486,111 D318V probably benign Het
Pcnx2 T A 8: 125,818,786 E1162V probably damaging Het
Pde2a G A 7: 101,511,154 R845H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Ppl T C 16: 5,087,980 K1484E possibly damaging Het
Pramel7 T C 2: 87,491,331 E120G probably benign Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Prpf6 T A 2: 181,608,174 D42E possibly damaging Het
Rbm5 C T 9: 107,750,519 V408I possibly damaging Het
Rsrp1 G T 4: 134,924,077 D51Y unknown Het
Sec22a A G 16: 35,347,718 M141T probably damaging Het
Spryd3 A G 15: 102,117,659 S417P probably benign Het
Sptbn2 A G 19: 4,732,685 M550V possibly damaging Het
Sugt1 C T 14: 79,608,994 T157I probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tas2r122 A T 6: 132,711,102 L276* probably null Het
Tbc1d14 G A 5: 36,507,693 S231F probably damaging Het
Tgm2 C T 2: 158,124,219 C505Y probably damaging Het
Thop1 T C 10: 81,073,317 Y61H probably damaging Het
Ticam1 G A 17: 56,271,436 H220Y probably damaging Het
Tle6 T C 10: 81,591,921 D500G possibly damaging Het
Tm6sf2 T A 8: 70,079,725 L345Q probably damaging Het
Tnxb T C 17: 34,670,874 C114R probably damaging Het
Topors G T 4: 40,262,149 C378* probably null Het
Ttc6 G A 12: 57,714,095 G1544R probably benign Het
Vmn2r4 A T 3: 64,406,989 N190K probably benign Het
Wdr70 C A 15: 7,920,573 V447F probably benign Het
Xpa A G 4: 46,155,730 probably benign Het
Xrcc1 T C 7: 24,570,575 S474P possibly damaging Het
Zfp658 T G 7: 43,573,899 F533V possibly damaging Het
Zfp799 G A 17: 32,819,400 H631Y probably damaging Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48235607 missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48293657 missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48276156 missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48343316 missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48417179 missense probably benign 0.05
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48417006 critical splice donor site probably null
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48674550 missense probably benign 0.17
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2237:Tenm3 UTSW 8 48342337 missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48278961 nonsense probably null
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48235826 missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48646498 missense probably benign 0.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48417059 missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense probably benign 0.00
R7140:Tenm3 UTSW 8 48292236 missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48300969 missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48235935 missense probably damaging 1.00
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGGTCATGCTTTTCAGACAC -3'
(R):5'- AGATGCCAAACTCAATGCGC -3'

Sequencing Primer
(F):5'- CGTTGGTGCCTATGGTCAACC -3'
(R):5'- AACTCAATGCGCCGTCCTC -3'
Posted On2014-06-23