Incidental Mutation 'R1863:Pcdhb17'
ID204172
Institutional Source Beutler Lab
Gene Symbol Pcdhb17
Ensembl Gene ENSMUSG00000046387
Gene Nameprotocadherin beta 17
SynonymsPcdhbQ, Pcdhb16
MMRRC Submission 039886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1863 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37484795-37489454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37486111 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 318 (D318V)
Ref Sequence ENSEMBL: ENSMUSP00000055072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051442] [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051442
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053856
AA Change: D318V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387
AA Change: D318V

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055949
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.0%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,593 I2108V probably benign Het
A2ml1 A T 6: 128,550,783 S1015T probably damaging Het
Adamts10 T A 17: 33,551,432 probably null Het
Adgrv1 G A 13: 81,563,566 T1097I probably damaging Het
Apeh T C 9: 108,092,103 Y274C possibly damaging Het
Apobec3 A G 15: 79,897,867 D26G possibly damaging Het
Arg2 C T 12: 79,150,020 Q172* probably null Het
Asb18 C T 1: 90,014,382 V66I probably benign Het
Cacna1i G A 15: 80,358,931 G430S probably damaging Het
Cadps A G 14: 12,449,802 S1136P possibly damaging Het
Cadps A G 14: 12,505,796 V758A probably benign Het
Calhm3 A G 19: 47,152,100 W185R probably damaging Het
Car5b T C X: 163,991,373 D146G probably damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cd300lg T G 11: 102,041,604 V5G probably damaging Het
Cd46 C A 1: 195,083,623 G145C probably damaging Het
Chit1 T C 1: 134,151,250 S433P probably damaging Het
Cntrl G A 2: 35,118,119 E182K possibly damaging Het
Col6a5 T A 9: 105,940,201 M304L unknown Het
Cpxm2 C T 7: 132,143,663 probably null Het
Dbf4 G A 5: 8,397,375 Q612* probably null Het
Dnah11 G C 12: 118,063,852 Q1835E possibly damaging Het
Ehbp1l1 A T 19: 5,717,854 N1140K probably benign Het
Eps8l1 C A 7: 4,465,360 probably benign Het
Fbxl21 A T 13: 56,527,063 I76L probably benign Het
Gcnt2 A T 13: 40,861,101 K249N possibly damaging Het
Gm11487 A T 4: 73,401,800 Y247* probably null Het
Gm5819 A G 18: 8,694,179 T35A probably benign Het
Gm8180 T C 14: 43,783,682 E23G probably benign Het
Gorab A G 1: 163,403,562 F8L probably damaging Het
Hlf A G 11: 90,340,826 L274S probably damaging Het
Il15ra T A 2: 11,723,436 S137T possibly damaging Het
Krt78 A T 15: 101,946,569 C936S possibly damaging Het
Lamb2 T C 9: 108,481,384 S207P probably benign Het
Lce1a1 T C 3: 92,646,811 S119G unknown Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrp4 T A 2: 91,498,363 L1536Q probably benign Het
Lrrc25 T C 8: 70,617,946 S126P possibly damaging Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mss51 C T 14: 20,484,868 R278H probably damaging Het
Myom3 G A 4: 135,778,037 M412I probably benign Het
Naa25 T C 5: 121,435,548 V780A probably benign Het
Naip6 A T 13: 100,300,559 F485L probably benign Het
Notch1 T C 2: 26,469,950 Y1251C probably damaging Het
Npas3 A G 12: 54,068,826 N826D probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1247 A T 2: 89,609,709 L131* probably null Het
Olfr1260 A T 2: 89,978,410 I211F probably benign Het
Olfr143 T G 9: 38,253,720 M101R probably damaging Het
Olfr285 G T 15: 98,313,491 Q20K probably benign Het
Olfr328 T C 11: 58,552,023 Y72C probably benign Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr798 T C 10: 129,625,348 T238A probably damaging Het
Osbpl6 G A 2: 76,585,058 R588H probably damaging Het
Pcnx2 T A 8: 125,818,786 E1162V probably damaging Het
Pde2a G A 7: 101,511,154 R845H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Ppl T C 16: 5,087,980 K1484E possibly damaging Het
Pramel7 T C 2: 87,491,331 E120G probably benign Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Prpf6 T A 2: 181,608,174 D42E possibly damaging Het
Rbm5 C T 9: 107,750,519 V408I possibly damaging Het
Rsrp1 G T 4: 134,924,077 D51Y unknown Het
Sec22a A G 16: 35,347,718 M141T probably damaging Het
Spryd3 A G 15: 102,117,659 S417P probably benign Het
Sptbn2 A G 19: 4,732,685 M550V possibly damaging Het
Sugt1 C T 14: 79,608,994 T157I probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tas2r122 A T 6: 132,711,102 L276* probably null Het
Tbc1d14 G A 5: 36,507,693 S231F probably damaging Het
Tenm3 T A 8: 48,276,346 I1526F probably benign Het
Tgm2 C T 2: 158,124,219 C505Y probably damaging Het
Thop1 T C 10: 81,073,317 Y61H probably damaging Het
Ticam1 G A 17: 56,271,436 H220Y probably damaging Het
Tle6 T C 10: 81,591,921 D500G possibly damaging Het
Tm6sf2 T A 8: 70,079,725 L345Q probably damaging Het
Tnxb T C 17: 34,670,874 C114R probably damaging Het
Topors G T 4: 40,262,149 C378* probably null Het
Ttc6 G A 12: 57,714,095 G1544R probably benign Het
Vmn2r4 A T 3: 64,406,989 N190K probably benign Het
Wdr70 C A 15: 7,920,573 V447F probably benign Het
Xpa A G 4: 46,155,730 probably benign Het
Xrcc1 T C 7: 24,570,575 S474P possibly damaging Het
Zfp658 T G 7: 43,573,899 F533V possibly damaging Het
Zfp799 G A 17: 32,819,400 H631Y probably damaging Het
Other mutations in Pcdhb17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Pcdhb17 APN 18 37486006 unclassified probably null
IGL01367:Pcdhb17 APN 18 37487495 missense probably benign 0.01
IGL01923:Pcdhb17 APN 18 37486737 missense probably benign 0.43
IGL02060:Pcdhb17 APN 18 37486416 missense probably damaging 1.00
IGL02494:Pcdhb17 APN 18 37485294 missense possibly damaging 0.73
IGL02654:Pcdhb17 APN 18 37486561 missense probably benign 0.03
IGL03168:Pcdhb17 APN 18 37485772 missense probably benign 0.15
doughnut UTSW 18 37486936 missense probably damaging 1.00
miniscule UTSW 18 37485667 missense probably damaging 1.00
R0364:Pcdhb17 UTSW 18 37485835 missense possibly damaging 0.95
R1013:Pcdhb17 UTSW 18 37485967 missense probably damaging 1.00
R1052:Pcdhb17 UTSW 18 37486846 missense probably damaging 1.00
R1226:Pcdhb17 UTSW 18 37487260 missense probably damaging 1.00
R1258:Pcdhb17 UTSW 18 37485534 missense probably damaging 0.98
R1335:Pcdhb17 UTSW 18 37486234 missense probably damaging 1.00
R1443:Pcdhb17 UTSW 18 37486648 missense probably benign 0.15
R1451:Pcdhb17 UTSW 18 37486936 missense probably damaging 1.00
R1505:Pcdhb17 UTSW 18 37486822 missense probably damaging 1.00
R1591:Pcdhb17 UTSW 18 37485825 missense probably damaging 1.00
R1742:Pcdhb17 UTSW 18 37486576 missense probably damaging 0.99
R1750:Pcdhb17 UTSW 18 37485711 missense probably damaging 1.00
R1750:Pcdhb17 UTSW 18 37487017 missense possibly damaging 0.81
R1764:Pcdhb17 UTSW 18 37487271 missense probably damaging 1.00
R1888:Pcdhb17 UTSW 18 37487385 unclassified probably null
R1888:Pcdhb17 UTSW 18 37487385 unclassified probably null
R2095:Pcdhb17 UTSW 18 37486322 missense probably benign 0.14
R4565:Pcdhb17 UTSW 18 37486470 missense probably benign 0.14
R4658:Pcdhb17 UTSW 18 37486599 missense probably damaging 1.00
R4669:Pcdhb17 UTSW 18 37486206 missense probably damaging 0.99
R4816:Pcdhb17 UTSW 18 37487397 missense probably benign 0.39
R4910:Pcdhb17 UTSW 18 37485159 start codon destroyed possibly damaging 0.90
R5209:Pcdhb17 UTSW 18 37487461 missense probably damaging 1.00
R5248:Pcdhb17 UTSW 18 37485886 missense probably benign 0.00
R5254:Pcdhb17 UTSW 18 37486825 missense probably damaging 1.00
R5494:Pcdhb17 UTSW 18 37487247 missense probably damaging 1.00
R5544:Pcdhb17 UTSW 18 37487421 missense possibly damaging 0.61
R5952:Pcdhb17 UTSW 18 37487080 missense probably benign 0.04
R5977:Pcdhb17 UTSW 18 37485667 missense probably damaging 1.00
R6262:Pcdhb17 UTSW 18 37486698 missense probably damaging 1.00
R6311:Pcdhb17 UTSW 18 37486263 unclassified probably null
R6495:Pcdhb17 UTSW 18 37485667 missense probably damaging 1.00
R6710:Pcdhb17 UTSW 18 37485399 missense probably damaging 0.96
X0062:Pcdhb17 UTSW 18 37486489 missense probably benign
X0064:Pcdhb17 UTSW 18 37486431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCGAGTGCAAATTCCCG -3'
(R):5'- TCCATTGTTCGCTGAATCAGG -3'

Sequencing Primer
(F):5'- GAGTGCAAATTCCCGAGAACAGTC -3'
(R):5'- CGCTGAATCAGGATCTTTAACACTG -3'
Posted On2014-06-23