Incidental Mutation 'R1859:Fam135a'
ID204179
Institutional Source Beutler Lab
Gene Symbol Fam135a
Ensembl Gene ENSMUSG00000026153
Gene Namefamily with sequence similarity 135, member A
Synonyms4921533L14Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R1859 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location24011093-24100341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24030225 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 521 (V521E)
Ref Sequence ENSEMBL: ENSMUSP00000027337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027337] [ENSMUST00000185807] [ENSMUST00000186331] [ENSMUST00000186999] [ENSMUST00000187369] [ENSMUST00000187752] [ENSMUST00000188712]
Predicted Effect probably damaging
Transcript: ENSMUST00000027337
AA Change: V521E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027337
Gene: ENSMUSG00000026153
AA Change: V521E

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
coiled coil region 270 295 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 1072 1085 N/A INTRINSIC
Blast:LRRNT 1139 1172 4e-6 BLAST
low complexity region 1173 1184 N/A INTRINSIC
Pfam:DUF676 1235 1431 9e-65 PFAM
Pfam:PGAP1 1237 1440 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185807
SMART Domains Protein: ENSMUSP00000140078
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
Blast:LRRNT 27 60 4e-7 BLAST
low complexity region 61 72 N/A INTRINSIC
Pfam:DUF676 104 161 2.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186331
SMART Domains Protein: ENSMUSP00000140947
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
low complexity region 172 185 N/A INTRINSIC
Blast:LRRNT 239 272 1e-6 BLAST
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186999
SMART Domains Protein: ENSMUSP00000140198
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
Pfam:DUF3657 111 173 1.8e-15 PFAM
Pfam:DUF3657 338 395 7.3e-8 PFAM
low complexity region 672 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187369
SMART Domains Protein: ENSMUSP00000140766
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
Pfam:DUF3657 111 173 3e-15 PFAM
coiled coil region 270 295 N/A INTRINSIC
Pfam:DUF3657 312 369 1.2e-7 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Blast:LRRNT 943 976 4e-6 BLAST
low complexity region 977 988 N/A INTRINSIC
Pfam:DUF676 1039 1235 6.8e-62 PFAM
Pfam:PGAP1 1041 1259 8.1e-5 PFAM
Pfam:LCAT 1097 1203 2.3e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187619
Predicted Effect probably benign
Transcript: ENSMUST00000187752
SMART Domains Protein: ENSMUSP00000139633
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
Pfam:DUF3657 68 130 3e-15 PFAM
Pfam:DUF3657 295 352 1.2e-7 PFAM
low complexity region 629 640 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Blast:LRRNT 926 959 4e-6 BLAST
low complexity region 960 971 N/A INTRINSIC
Pfam:DUF676 1022 1218 6.7e-62 PFAM
Pfam:PGAP1 1024 1242 8e-5 PFAM
Pfam:LCAT 1080 1186 2.2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188712
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,670,834 probably benign Het
9930021J03Rik A C 19: 29,754,923 C230G possibly damaging Het
Adcy10 A G 1: 165,521,961 E467G probably damaging Het
Alkbh8 A G 9: 3,385,499 D597G probably benign Het
Alpk1 T A 3: 127,681,100 H418L possibly damaging Het
Ano5 G T 7: 51,546,833 V138L probably damaging Het
Aspg T A 12: 112,121,172 I319K possibly damaging Het
Atp9b T C 18: 80,749,920 T970A possibly damaging Het
C4b T A 17: 34,735,553 M881L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdca5 T C 19: 6,090,094 V95A possibly damaging Het
Cds2 A G 2: 132,302,195 Y297C probably damaging Het
Celsr2 C T 3: 108,396,630 G2371S probably damaging Het
Chd5 T A 4: 152,380,523 I1557N probably benign Het
Cntn5 C T 9: 9,972,834 E266K probably damaging Het
Crtam G A 9: 40,973,604 T363M possibly damaging Het
Dnah2 A G 11: 69,437,886 S3298P probably damaging Het
Dok1 A T 6: 83,032,245 Y209N probably damaging Het
Dpp10 T C 1: 123,353,604 D561G possibly damaging Het
Drosha A G 15: 12,878,718 K710R probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Ercc6 T C 14: 32,526,778 S429P probably damaging Het
Fbxl7 A T 15: 26,543,193 L456Q probably damaging Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Foxc2 G T 8: 121,116,625 R4L probably damaging Het
Glyctk C T 9: 106,157,532 V112I probably benign Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Guf1 G T 5: 69,568,460 G481* probably null Het
Heatr1 T C 13: 12,403,159 L324S probably damaging Het
Hectd1 A G 12: 51,806,567 L57P probably damaging Het
Hmcn1 A T 1: 150,657,193 C3080S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifit1 T A 19: 34,647,544 F27I probably benign Het
Ift20 G T 11: 78,540,034 E68* probably null Het
Itsn1 A G 16: 91,889,154 probably benign Het
Ksr2 T A 5: 117,414,941 L38Q probably damaging Het
Lama2 A T 10: 27,031,082 M2361K possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k9 A T 12: 81,724,482 S800R possibly damaging Het
Mef2a A G 7: 67,266,018 S179P probably damaging Het
Micall1 A G 15: 79,122,945 probably benign Het
Mpg A G 11: 32,231,957 probably null Het
Mpp7 A T 18: 7,350,967 *577K probably null Het
Msh4 G T 3: 153,905,880 H35Q probably benign Het
Mst1 G A 9: 108,084,346 V601I probably benign Het
Myh10 T A 11: 68,745,413 N246K probably benign Het
Myom3 C A 4: 135,779,396 N493K probably benign Het
Mypn T C 10: 63,146,190 D537G probably benign Het
Ncan A T 8: 70,115,348 M38K possibly damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nos1 A T 5: 117,905,462 N601Y possibly damaging Het
Nrxn2 G A 19: 6,488,795 V794I probably benign Het
Olfr1099 T C 2: 86,959,081 I126V probably damaging Het
Olfr1390 T C 11: 49,341,384 L284P probably damaging Het
Olfr1495 T A 19: 13,768,724 Y127* probably null Het
Olfr156 A T 4: 43,820,779 I194N possibly damaging Het
Olfr45 T A 7: 140,691,658 V251E possibly damaging Het
Parp4 T C 14: 56,648,915 V1817A unknown Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Ppp1r3c T C 19: 36,733,611 N253S probably damaging Het
Prdm5 A G 6: 65,831,279 I42V probably benign Het
Prom2 T G 2: 127,541,097 Q75P probably damaging Het
Ptpn23 T C 9: 110,388,870 D669G possibly damaging Het
Rag1 T C 2: 101,644,062 D245G probably benign Het
Rpl22l1 T A 3: 28,806,598 probably null Het
Sars2 T C 7: 28,744,312 V113A probably damaging Het
Sbno2 T A 10: 80,058,639 K1067* probably null Het
Sec61g A G 11: 16,506,371 probably null Het
Slc4a11 A T 2: 130,688,012 M282K probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Sparc A T 11: 55,406,508 probably null Het
Thra T A 11: 98,756,151 C33S probably damaging Het
Tmem2 T C 19: 21,847,977 V1213A possibly damaging Het
Trrap A T 5: 144,830,951 T2293S probably benign Het
Ttn T A 2: 76,894,645 probably benign Het
Vat1l T A 8: 114,271,301 V195E probably damaging Het
Vmn1r60 T A 7: 5,544,550 I184F possibly damaging Het
Wdfy4 A G 14: 33,103,983 I1192T probably damaging Het
Zbtb10 T C 3: 9,280,386 S737P possibly damaging Het
Zfp553 A G 7: 127,235,345 E24G probably benign Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Fam135a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Fam135a APN 1 24055898 missense probably damaging 1.00
IGL01993:Fam135a APN 1 24055911 missense probably damaging 0.99
IGL02172:Fam135a APN 1 24024780 critical splice donor site probably null
IGL02832:Fam135a APN 1 24028633 missense probably benign 0.00
IGL03075:Fam135a APN 1 24030906 splice site probably benign
IGL03197:Fam135a APN 1 24044182 missense probably damaging 1.00
IGL03214:Fam135a APN 1 24053276 missense probably damaging 1.00
IGL03355:Fam135a APN 1 24029168 missense possibly damaging 0.93
PIT4434001:Fam135a UTSW 1 24029195 missense probably benign
R0276:Fam135a UTSW 1 24067964 missense probably damaging 1.00
R1429:Fam135a UTSW 1 24044267 missense probably damaging 1.00
R1553:Fam135a UTSW 1 24021870 missense probably damaging 0.97
R1582:Fam135a UTSW 1 24029317 missense probably damaging 1.00
R1686:Fam135a UTSW 1 24029806 missense probably benign 0.05
R1732:Fam135a UTSW 1 24026653 missense possibly damaging 0.71
R1954:Fam135a UTSW 1 24029602 missense probably damaging 1.00
R2266:Fam135a UTSW 1 24028797 missense probably benign 0.22
R2570:Fam135a UTSW 1 24021964 missense probably damaging 1.00
R3725:Fam135a UTSW 1 24057434 nonsense probably null
R3740:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3741:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3765:Fam135a UTSW 1 24055877 missense possibly damaging 0.95
R3792:Fam135a UTSW 1 24028311 missense probably benign 0.14
R3940:Fam135a UTSW 1 24057475 missense probably damaging 0.98
R3946:Fam135a UTSW 1 24030394 missense probably damaging 0.96
R4754:Fam135a UTSW 1 24028754 nonsense probably null
R4794:Fam135a UTSW 1 24029160 missense probably benign 0.36
R4887:Fam135a UTSW 1 24024253 nonsense probably null
R4891:Fam135a UTSW 1 24030328 missense probably benign 0.00
R4929:Fam135a UTSW 1 24030000 missense probably benign 0.16
R4999:Fam135a UTSW 1 24020677 missense possibly damaging 0.83
R5092:Fam135a UTSW 1 24028807 missense probably benign 0.11
R5205:Fam135a UTSW 1 24029511 missense probably benign 0.05
R5313:Fam135a UTSW 1 24028585 missense possibly damaging 0.89
R5579:Fam135a UTSW 1 24029727 missense possibly damaging 0.93
R5689:Fam135a UTSW 1 24029053 missense probably benign 0.22
R5863:Fam135a UTSW 1 24014782 missense possibly damaging 0.94
R5869:Fam135a UTSW 1 24029430 missense possibly damaging 0.53
R6128:Fam135a UTSW 1 24030740 critical splice donor site probably null
R6505:Fam135a UTSW 1 24014872 missense probably damaging 1.00
R6668:Fam135a UTSW 1 24028848 missense probably damaging 0.99
R6793:Fam135a UTSW 1 24067925 missense possibly damaging 0.69
R6857:Fam135a UTSW 1 24014789 missense probably damaging 0.99
R6931:Fam135a UTSW 1 24085487 start codon destroyed probably damaging 1.00
R6977:Fam135a UTSW 1 24054098 missense probably damaging 1.00
R7187:Fam135a UTSW 1 24044214 missense probably damaging 1.00
R7206:Fam135a UTSW 1 24030273 missense probably benign 0.14
R7305:Fam135a UTSW 1 24030858 missense probably damaging 1.00
R7313:Fam135a UTSW 1 24057392 missense probably damaging 0.98
R7420:Fam135a UTSW 1 24012486 missense possibly damaging 0.68
X0022:Fam135a UTSW 1 24030214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGGAGACTTATGTTCACTTCTG -3'
(R):5'- AGCCCAGAGTTGAAGGTCAG -3'

Sequencing Primer
(F):5'- ACTTCTGTCTGTGTTAGCTGACAAAG -3'
(R):5'- AGACCTGCTGTTGCCTCCAG -3'
Posted On2014-06-23