Incidental Mutation 'R1859:Cds2'
ID204191
Institutional Source Beutler Lab
Gene Symbol Cds2
Ensembl Gene ENSMUSG00000058793
Gene NameCDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Synonyms5730460C18Rik, 5730450N06Rik, D2Wsu127e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1859 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location132263148-132312050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132302195 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 297 (Y297C)
Ref Sequence ENSEMBL: ENSMUSP00000086886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089461] [ENSMUST00000103181] [ENSMUST00000147456]
Predicted Effect probably damaging
Transcript: ENSMUST00000089461
AA Change: Y297C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086886
Gene: ENSMUSG00000058793
AA Change: Y297C

DomainStartEndE-ValueType
Pfam:CTP_transf_1 52 382 5e-90 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103181
AA Change: Y314C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099470
Gene: ENSMUSG00000058793
AA Change: Y314C

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 399 7.6e-90 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000138194
AA Change: Y40C
SMART Domains Protein: ENSMUSP00000121769
Gene: ENSMUSG00000058793
AA Change: Y40C

DomainStartEndE-ValueType
Pfam:CTP_transf_1 3 126 8.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147456
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. Heterozygotes show a distorted lymphocyte distribution and enhanced sensorimotor gating. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,670,834 probably benign Het
9930021J03Rik A C 19: 29,754,923 C230G possibly damaging Het
Adcy10 A G 1: 165,521,961 E467G probably damaging Het
Alkbh8 A G 9: 3,385,499 D597G probably benign Het
Alpk1 T A 3: 127,681,100 H418L possibly damaging Het
Ano5 G T 7: 51,546,833 V138L probably damaging Het
Aspg T A 12: 112,121,172 I319K possibly damaging Het
Atp9b T C 18: 80,749,920 T970A possibly damaging Het
C4b T A 17: 34,735,553 M881L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdca5 T C 19: 6,090,094 V95A possibly damaging Het
Celsr2 C T 3: 108,396,630 G2371S probably damaging Het
Chd5 T A 4: 152,380,523 I1557N probably benign Het
Cntn5 C T 9: 9,972,834 E266K probably damaging Het
Crtam G A 9: 40,973,604 T363M possibly damaging Het
Dnah2 A G 11: 69,437,886 S3298P probably damaging Het
Dok1 A T 6: 83,032,245 Y209N probably damaging Het
Dpp10 T C 1: 123,353,604 D561G possibly damaging Het
Drosha A G 15: 12,878,718 K710R probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Ercc6 T C 14: 32,526,778 S429P probably damaging Het
Fam135a A T 1: 24,030,225 V521E probably damaging Het
Fbxl7 A T 15: 26,543,193 L456Q probably damaging Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Foxc2 G T 8: 121,116,625 R4L probably damaging Het
Glyctk C T 9: 106,157,532 V112I probably benign Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Guf1 G T 5: 69,568,460 G481* probably null Het
Heatr1 T C 13: 12,403,159 L324S probably damaging Het
Hectd1 A G 12: 51,806,567 L57P probably damaging Het
Hmcn1 A T 1: 150,657,193 C3080S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifit1 T A 19: 34,647,544 F27I probably benign Het
Ift20 G T 11: 78,540,034 E68* probably null Het
Itsn1 A G 16: 91,889,154 probably benign Het
Ksr2 T A 5: 117,414,941 L38Q probably damaging Het
Lama2 A T 10: 27,031,082 M2361K possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k9 A T 12: 81,724,482 S800R possibly damaging Het
Mef2a A G 7: 67,266,018 S179P probably damaging Het
Micall1 A G 15: 79,122,945 probably benign Het
Mpg A G 11: 32,231,957 probably null Het
Mpp7 A T 18: 7,350,967 *577K probably null Het
Msh4 G T 3: 153,905,880 H35Q probably benign Het
Mst1 G A 9: 108,084,346 V601I probably benign Het
Myh10 T A 11: 68,745,413 N246K probably benign Het
Myom3 C A 4: 135,779,396 N493K probably benign Het
Mypn T C 10: 63,146,190 D537G probably benign Het
Ncan A T 8: 70,115,348 M38K possibly damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nos1 A T 5: 117,905,462 N601Y possibly damaging Het
Nrxn2 G A 19: 6,488,795 V794I probably benign Het
Olfr1099 T C 2: 86,959,081 I126V probably damaging Het
Olfr1390 T C 11: 49,341,384 L284P probably damaging Het
Olfr1495 T A 19: 13,768,724 Y127* probably null Het
Olfr156 A T 4: 43,820,779 I194N possibly damaging Het
Olfr45 T A 7: 140,691,658 V251E possibly damaging Het
Parp4 T C 14: 56,648,915 V1817A unknown Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Ppp1r3c T C 19: 36,733,611 N253S probably damaging Het
Prdm5 A G 6: 65,831,279 I42V probably benign Het
Prom2 T G 2: 127,541,097 Q75P probably damaging Het
Ptpn23 T C 9: 110,388,870 D669G possibly damaging Het
Rag1 T C 2: 101,644,062 D245G probably benign Het
Rpl22l1 T A 3: 28,806,598 probably null Het
Sars2 T C 7: 28,744,312 V113A probably damaging Het
Sbno2 T A 10: 80,058,639 K1067* probably null Het
Sec61g A G 11: 16,506,371 probably null Het
Slc4a11 A T 2: 130,688,012 M282K probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Sparc A T 11: 55,406,508 probably null Het
Thra T A 11: 98,756,151 C33S probably damaging Het
Tmem2 T C 19: 21,847,977 V1213A possibly damaging Het
Trrap A T 5: 144,830,951 T2293S probably benign Het
Ttn T A 2: 76,894,645 probably benign Het
Vat1l T A 8: 114,271,301 V195E probably damaging Het
Vmn1r60 T A 7: 5,544,550 I184F possibly damaging Het
Wdfy4 A G 14: 33,103,983 I1192T probably damaging Het
Zbtb10 T C 3: 9,280,386 S737P possibly damaging Het
Zfp553 A G 7: 127,235,345 E24G probably benign Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Cds2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cds2 APN 2 132297293 missense probably damaging 1.00
IGL00434:Cds2 APN 2 132293351 missense probably damaging 0.99
IGL00771:Cds2 APN 2 132304352 splice site probably benign
IGL00984:Cds2 APN 2 132298521 missense probably benign 0.02
IGL02041:Cds2 APN 2 132294443 missense possibly damaging 0.94
sugarless UTSW 2 132298483 missense probably damaging 1.00
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0452:Cds2 UTSW 2 132298479 missense probably damaging 0.99
R0455:Cds2 UTSW 2 132285967 critical splice donor site probably null
R0593:Cds2 UTSW 2 132297376 unclassified probably benign
R0831:Cds2 UTSW 2 132285967 critical splice donor site probably null
R1053:Cds2 UTSW 2 132305260 missense probably damaging 1.00
R1669:Cds2 UTSW 2 132295519 splice site probably null
R1740:Cds2 UTSW 2 132302213 missense possibly damaging 0.63
R4125:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4126:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4128:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4352:Cds2 UTSW 2 132263445 start codon destroyed probably null 0.37
R4467:Cds2 UTSW 2 132294446 nonsense probably null
R4698:Cds2 UTSW 2 132304953 missense probably damaging 0.97
R4704:Cds2 UTSW 2 132300602 nonsense probably null
R4917:Cds2 UTSW 2 132298478 missense probably damaging 0.98
R5070:Cds2 UTSW 2 132302088 nonsense probably null
R5199:Cds2 UTSW 2 132298483 missense probably damaging 1.00
R5431:Cds2 UTSW 2 132302170 missense probably benign 0.28
R5704:Cds2 UTSW 2 132293329 missense probably benign 0.01
R5858:Cds2 UTSW 2 132302113 missense probably benign 0.00
R5946:Cds2 UTSW 2 132297248 missense probably damaging 1.00
R5954:Cds2 UTSW 2 132297271 missense probably benign 0.00
R7195:Cds2 UTSW 2 132293284 missense probably benign 0.28
R7234:Cds2 UTSW 2 132304480 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGAGTCATGGCCCAATCAG -3'
(R):5'- ACTCAGTAAGCAGGATCCTCTAGG -3'

Sequencing Primer
(F):5'- AGTCATGGCCCAATCAGGTGTC -3'
(R):5'- TCCTCTAGGAATCCACACAATGTG -3'
Posted On2014-06-23