Incidental Mutation 'R1859:Nos1'
ID204204
Institutional Source Beutler Lab
Gene Symbol Nos1
Ensembl Gene ENSMUSG00000029361
Gene Namenitric oxide synthase 1, neuronal
SynonymsbNOS, nNOS, 2310005C01Rik, Nos-1, NO
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1859 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location117781032-117958840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117905462 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 601 (N601Y)
Ref Sequence ENSEMBL: ENSMUSP00000127432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086451] [ENSMUST00000102557] [ENSMUST00000142742] [ENSMUST00000171055]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086451
AA Change: N601Y

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138506
Gene: ENSMUSG00000029361
AA Change: N601Y

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 1e-226 PFAM
Pfam:Flavodoxin_1 757 930 3.5e-56 PFAM
Pfam:FAD_binding_1 985 1214 1.1e-84 PFAM
Pfam:NAD_binding_1 1246 1360 2.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102557
AA Change: N601Y

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099617
Gene: ENSMUSG00000029361
AA Change: N601Y

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 350 712 2e-196 PFAM
Pfam:Flavodoxin_1 757 964 2.3e-55 PFAM
Pfam:FAD_binding_1 1019 1248 2.9e-88 PFAM
Pfam:NAD_binding_1 1280 1394 2.6e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142742
AA Change: N601Y

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120421
Gene: ENSMUSG00000029361
AA Change: N601Y

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171055
AA Change: N601Y

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127432
Gene: ENSMUSG00000029361
AA Change: N601Y

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of nitric oxide synthases, which synthesize nitric oxide from L-arginine. Nitric oxide is a reactive free radical, which acts as a biologic mediator in several processes, including neurotransmission, and antimicrobial and antitumoral activities. In the brain and peripheral nervous system, nitric oxide displays many properties of a neurotransmitter, and has been implicated in neurotoxicity associated with stroke and neurodegenerative diseases, neural regulation of smooth muscle, including peristalsis, and penile erection. This protein is ubiquitously expressed, with high level of expression in skeletal muscle. Multiple transcript variants that differ in the 5' UTR have been described for this gene but the full-length nature of these transcripts is not known. Additionally, alternatively spliced transcript variants encoding different isoforms (some testis-specific) have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice exhibit enlarged stomachs, abnormal pyloric and lower esophageal sphincters, age-related cardiac hypertrophy, altered alcohol consumption and responses, decreased ovulation and reduced REM sleep. Homozygous null mice display increased neurogenesis in the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,670,834 probably benign Het
9930021J03Rik A C 19: 29,754,923 C230G possibly damaging Het
Adcy10 A G 1: 165,521,961 E467G probably damaging Het
Alkbh8 A G 9: 3,385,499 D597G probably benign Het
Alpk1 T A 3: 127,681,100 H418L possibly damaging Het
Ano5 G T 7: 51,546,833 V138L probably damaging Het
Aspg T A 12: 112,121,172 I319K possibly damaging Het
Atp9b T C 18: 80,749,920 T970A possibly damaging Het
C4b T A 17: 34,735,553 M881L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdca5 T C 19: 6,090,094 V95A possibly damaging Het
Cds2 A G 2: 132,302,195 Y297C probably damaging Het
Celsr2 C T 3: 108,396,630 G2371S probably damaging Het
Chd5 T A 4: 152,380,523 I1557N probably benign Het
Cntn5 C T 9: 9,972,834 E266K probably damaging Het
Crtam G A 9: 40,973,604 T363M possibly damaging Het
Dnah2 A G 11: 69,437,886 S3298P probably damaging Het
Dok1 A T 6: 83,032,245 Y209N probably damaging Het
Dpp10 T C 1: 123,353,604 D561G possibly damaging Het
Drosha A G 15: 12,878,718 K710R probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Ercc6 T C 14: 32,526,778 S429P probably damaging Het
Fam135a A T 1: 24,030,225 V521E probably damaging Het
Fbxl7 A T 15: 26,543,193 L456Q probably damaging Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Foxc2 G T 8: 121,116,625 R4L probably damaging Het
Glyctk C T 9: 106,157,532 V112I probably benign Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Guf1 G T 5: 69,568,460 G481* probably null Het
Heatr1 T C 13: 12,403,159 L324S probably damaging Het
Hectd1 A G 12: 51,806,567 L57P probably damaging Het
Hmcn1 A T 1: 150,657,193 C3080S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifit1 T A 19: 34,647,544 F27I probably benign Het
Ift20 G T 11: 78,540,034 E68* probably null Het
Itsn1 A G 16: 91,889,154 probably benign Het
Ksr2 T A 5: 117,414,941 L38Q probably damaging Het
Lama2 A T 10: 27,031,082 M2361K possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k9 A T 12: 81,724,482 S800R possibly damaging Het
Mef2a A G 7: 67,266,018 S179P probably damaging Het
Micall1 A G 15: 79,122,945 probably benign Het
Mpg A G 11: 32,231,957 probably null Het
Mpp7 A T 18: 7,350,967 *577K probably null Het
Msh4 G T 3: 153,905,880 H35Q probably benign Het
Mst1 G A 9: 108,084,346 V601I probably benign Het
Myh10 T A 11: 68,745,413 N246K probably benign Het
Myom3 C A 4: 135,779,396 N493K probably benign Het
Mypn T C 10: 63,146,190 D537G probably benign Het
Ncan A T 8: 70,115,348 M38K possibly damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nrxn2 G A 19: 6,488,795 V794I probably benign Het
Olfr1099 T C 2: 86,959,081 I126V probably damaging Het
Olfr1390 T C 11: 49,341,384 L284P probably damaging Het
Olfr1495 T A 19: 13,768,724 Y127* probably null Het
Olfr156 A T 4: 43,820,779 I194N possibly damaging Het
Olfr45 T A 7: 140,691,658 V251E possibly damaging Het
Parp4 T C 14: 56,648,915 V1817A unknown Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Ppp1r3c T C 19: 36,733,611 N253S probably damaging Het
Prdm5 A G 6: 65,831,279 I42V probably benign Het
Prom2 T G 2: 127,541,097 Q75P probably damaging Het
Ptpn23 T C 9: 110,388,870 D669G possibly damaging Het
Rag1 T C 2: 101,644,062 D245G probably benign Het
Rpl22l1 T A 3: 28,806,598 probably null Het
Sars2 T C 7: 28,744,312 V113A probably damaging Het
Sbno2 T A 10: 80,058,639 K1067* probably null Het
Sec61g A G 11: 16,506,371 probably null Het
Slc4a11 A T 2: 130,688,012 M282K probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Sparc A T 11: 55,406,508 probably null Het
Thra T A 11: 98,756,151 C33S probably damaging Het
Tmem2 T C 19: 21,847,977 V1213A possibly damaging Het
Trrap A T 5: 144,830,951 T2293S probably benign Het
Ttn T A 2: 76,894,645 probably benign Het
Vat1l T A 8: 114,271,301 V195E probably damaging Het
Vmn1r60 T A 7: 5,544,550 I184F possibly damaging Het
Wdfy4 A G 14: 33,103,983 I1192T probably damaging Het
Zbtb10 T C 3: 9,280,386 S737P possibly damaging Het
Zfp553 A G 7: 127,235,345 E24G probably benign Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Nos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nos1 APN 5 117910100 missense probably damaging 0.99
IGL01155:Nos1 APN 5 117945926 missense probably damaging 0.99
IGL01462:Nos1 APN 5 117867709 missense probably benign 0.10
IGL01464:Nos1 APN 5 117943192 missense probably damaging 1.00
IGL01620:Nos1 APN 5 117905309 critical splice acceptor site probably null
IGL01621:Nos1 APN 5 117945884 missense probably damaging 1.00
IGL01796:Nos1 APN 5 117938274 nonsense probably null
IGL02003:Nos1 APN 5 117905465 missense probably damaging 1.00
IGL02274:Nos1 APN 5 117897780 missense probably damaging 1.00
IGL02885:Nos1 APN 5 117895790 missense probably damaging 1.00
IGL02947:Nos1 APN 5 117943317 missense probably damaging 0.99
IGL03088:Nos1 APN 5 117867258 missense probably damaging 1.00
IGL03166:Nos1 APN 5 117914452 splice site probably benign
R0007:Nos1 UTSW 5 117910088 missense probably damaging 1.00
R0012:Nos1 UTSW 5 117893902 missense probably damaging 1.00
R0080:Nos1 UTSW 5 117893878 missense probably damaging 1.00
R0212:Nos1 UTSW 5 117910212 missense possibly damaging 0.57
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0454:Nos1 UTSW 5 117943320 missense probably benign 0.00
R0494:Nos1 UTSW 5 117905474 missense probably damaging 1.00
R0882:Nos1 UTSW 5 117947447 missense probably damaging 1.00
R1099:Nos1 UTSW 5 117923395 missense probably damaging 0.96
R1243:Nos1 UTSW 5 117905472 missense probably damaging 1.00
R1387:Nos1 UTSW 5 117953783 splice site probably benign
R1432:Nos1 UTSW 5 117949619 splice site probably benign
R1698:Nos1 UTSW 5 117867232 missense probably benign 0.01
R1710:Nos1 UTSW 5 117895919 missense probably damaging 1.00
R1973:Nos1 UTSW 5 117936426 missense possibly damaging 0.52
R2084:Nos1 UTSW 5 117943245 missense probably damaging 1.00
R2112:Nos1 UTSW 5 117936571 missense probably benign 0.00
R4689:Nos1 UTSW 5 117879385 missense probably benign 0.04
R4769:Nos1 UTSW 5 117943245 nonsense probably null
R4893:Nos1 UTSW 5 117952877 missense possibly damaging 0.50
R4916:Nos1 UTSW 5 117947570 critical splice donor site probably null
R4956:Nos1 UTSW 5 117947510 missense probably benign
R4971:Nos1 UTSW 5 117943834 missense probably benign 0.05
R4987:Nos1 UTSW 5 117926533 critical splice donor site probably null
R5015:Nos1 UTSW 5 117867269 missense probably damaging 1.00
R5031:Nos1 UTSW 5 117879313 missense probably benign
R5137:Nos1 UTSW 5 117905313 missense probably benign 0.29
R5481:Nos1 UTSW 5 117867754 missense probably benign 0.06
R5541:Nos1 UTSW 5 117905394 missense probably damaging 1.00
R5655:Nos1 UTSW 5 117923257 missense probably damaging 1.00
R5866:Nos1 UTSW 5 117895902 missense probably damaging 0.97
R5934:Nos1 UTSW 5 117936445 missense probably damaging 0.99
R6158:Nos1 UTSW 5 117867574 missense probably benign 0.05
R6225:Nos1 UTSW 5 117912852 missense probably damaging 1.00
R6261:Nos1 UTSW 5 117936570 missense probably benign
R6388:Nos1 UTSW 5 117914436 missense possibly damaging 0.91
R6987:Nos1 UTSW 5 117895785 missense probably benign 0.05
R7104:Nos1 UTSW 5 117947431 missense probably damaging 1.00
R7136:Nos1 UTSW 5 117895860 missense possibly damaging 0.95
R7276:Nos1 UTSW 5 117910238 missense probably damaging 0.97
R7299:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7301:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7402:Nos1 UTSW 5 117949815 missense probably benign 0.34
R7408:Nos1 UTSW 5 117867518 missense probably damaging 1.00
X0025:Nos1 UTSW 5 117943825 missense probably benign 0.00
X0026:Nos1 UTSW 5 117943152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTGAAGATGCTGCTCAGG -3'
(R):5'- TTGCTTCTTCAGGTCTCGATAG -3'

Sequencing Primer
(F):5'- ATACTGGCTGCATGCTGAGC -3'
(R):5'- CTTCTTCAGGTCTCGATAGGAAAGAG -3'
Posted On2014-06-23