Incidental Mutation 'R1859:Trrap'
ID204205
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Nametransformation/transcription domain-associated protein
Synonymstransactivation/transformation-domain associated protein
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1859 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location144767732-144859778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144830951 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 2293 (T2293S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
Predicted Effect probably benign
Transcript: ENSMUST00000038980
AA Change: T2554S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: T2554S

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094120
AA Change: T2572S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: T2572S

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100467
AA Change: T2554S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: T2554S

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132347
Predicted Effect probably benign
Transcript: ENSMUST00000132925
AA Change: T2293S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: T2293S

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213013
AA Change: T2573S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,670,834 probably benign Het
9930021J03Rik A C 19: 29,754,923 C230G possibly damaging Het
Adcy10 A G 1: 165,521,961 E467G probably damaging Het
Alkbh8 A G 9: 3,385,499 D597G probably benign Het
Alpk1 T A 3: 127,681,100 H418L possibly damaging Het
Ano5 G T 7: 51,546,833 V138L probably damaging Het
Aspg T A 12: 112,121,172 I319K possibly damaging Het
Atp9b T C 18: 80,749,920 T970A possibly damaging Het
C4b T A 17: 34,735,553 M881L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdca5 T C 19: 6,090,094 V95A possibly damaging Het
Cds2 A G 2: 132,302,195 Y297C probably damaging Het
Celsr2 C T 3: 108,396,630 G2371S probably damaging Het
Chd5 T A 4: 152,380,523 I1557N probably benign Het
Cntn5 C T 9: 9,972,834 E266K probably damaging Het
Crtam G A 9: 40,973,604 T363M possibly damaging Het
Dnah2 A G 11: 69,437,886 S3298P probably damaging Het
Dok1 A T 6: 83,032,245 Y209N probably damaging Het
Dpp10 T C 1: 123,353,604 D561G possibly damaging Het
Drosha A G 15: 12,878,718 K710R probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Ercc6 T C 14: 32,526,778 S429P probably damaging Het
Fam135a A T 1: 24,030,225 V521E probably damaging Het
Fbxl7 A T 15: 26,543,193 L456Q probably damaging Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Foxc2 G T 8: 121,116,625 R4L probably damaging Het
Glyctk C T 9: 106,157,532 V112I probably benign Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Guf1 G T 5: 69,568,460 G481* probably null Het
Heatr1 T C 13: 12,403,159 L324S probably damaging Het
Hectd1 A G 12: 51,806,567 L57P probably damaging Het
Hmcn1 A T 1: 150,657,193 C3080S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifit1 T A 19: 34,647,544 F27I probably benign Het
Ift20 G T 11: 78,540,034 E68* probably null Het
Itsn1 A G 16: 91,889,154 probably benign Het
Ksr2 T A 5: 117,414,941 L38Q probably damaging Het
Lama2 A T 10: 27,031,082 M2361K possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k9 A T 12: 81,724,482 S800R possibly damaging Het
Mef2a A G 7: 67,266,018 S179P probably damaging Het
Micall1 A G 15: 79,122,945 probably benign Het
Mpg A G 11: 32,231,957 probably null Het
Mpp7 A T 18: 7,350,967 *577K probably null Het
Msh4 G T 3: 153,905,880 H35Q probably benign Het
Mst1 G A 9: 108,084,346 V601I probably benign Het
Myh10 T A 11: 68,745,413 N246K probably benign Het
Myom3 C A 4: 135,779,396 N493K probably benign Het
Mypn T C 10: 63,146,190 D537G probably benign Het
Ncan A T 8: 70,115,348 M38K possibly damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nos1 A T 5: 117,905,462 N601Y possibly damaging Het
Nrxn2 G A 19: 6,488,795 V794I probably benign Het
Olfr1099 T C 2: 86,959,081 I126V probably damaging Het
Olfr1390 T C 11: 49,341,384 L284P probably damaging Het
Olfr1495 T A 19: 13,768,724 Y127* probably null Het
Olfr156 A T 4: 43,820,779 I194N possibly damaging Het
Olfr45 T A 7: 140,691,658 V251E possibly damaging Het
Parp4 T C 14: 56,648,915 V1817A unknown Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Ppp1r3c T C 19: 36,733,611 N253S probably damaging Het
Prdm5 A G 6: 65,831,279 I42V probably benign Het
Prom2 T G 2: 127,541,097 Q75P probably damaging Het
Ptpn23 T C 9: 110,388,870 D669G possibly damaging Het
Rag1 T C 2: 101,644,062 D245G probably benign Het
Rpl22l1 T A 3: 28,806,598 probably null Het
Sars2 T C 7: 28,744,312 V113A probably damaging Het
Sbno2 T A 10: 80,058,639 K1067* probably null Het
Sec61g A G 11: 16,506,371 probably null Het
Slc4a11 A T 2: 130,688,012 M282K probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Sparc A T 11: 55,406,508 probably null Het
Thra T A 11: 98,756,151 C33S probably damaging Het
Tmem2 T C 19: 21,847,977 V1213A possibly damaging Het
Ttn T A 2: 76,894,645 probably benign Het
Vat1l T A 8: 114,271,301 V195E probably damaging Het
Vmn1r60 T A 7: 5,544,550 I184F possibly damaging Het
Wdfy4 A G 14: 33,103,983 I1192T probably damaging Het
Zbtb10 T C 3: 9,280,386 S737P possibly damaging Het
Zfp553 A G 7: 127,235,345 E24G probably benign Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144779974 splice site probably benign
IGL00470:Trrap APN 5 144818038 missense probably damaging 1.00
IGL00490:Trrap APN 5 144825225 missense probably benign 0.40
IGL01072:Trrap APN 5 144784255 splice site probably benign
IGL01087:Trrap APN 5 144846539 missense probably damaging 0.99
IGL01300:Trrap APN 5 144804818 missense probably damaging 1.00
IGL01350:Trrap APN 5 144830969 missense possibly damaging 0.92
IGL01410:Trrap APN 5 144831021 missense probably benign 0.00
IGL01571:Trrap APN 5 144833287 splice site probably benign
IGL01748:Trrap APN 5 144833340 missense probably damaging 1.00
IGL01839:Trrap APN 5 144821875 missense probably damaging 1.00
IGL01976:Trrap APN 5 144856989 missense probably benign 0.00
IGL02075:Trrap APN 5 144828494 missense probably benign 0.00
IGL02127:Trrap APN 5 144816433 missense probably benign 0.22
IGL02131:Trrap APN 5 144840436 missense probably damaging 1.00
IGL02287:Trrap APN 5 144832538 missense probably damaging 1.00
IGL02301:Trrap APN 5 144777917 missense probably benign 0.05
IGL02336:Trrap APN 5 144798390 missense probably benign 0.39
IGL02526:Trrap APN 5 144824550 missense probably benign 0.00
IGL02873:Trrap APN 5 144841079 splice site probably benign
IGL02953:Trrap APN 5 144815964 missense probably damaging 0.99
IGL03404:Trrap APN 5 144833186 missense probably benign 0.00
Card-tower UTSW 5 144804766 missense probably damaging 1.00
PIT4243001:Trrap UTSW 5 144796971 missense probably benign 0.00
PIT4466001:Trrap UTSW 5 144828600 missense probably benign 0.02
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0112:Trrap UTSW 5 144822761 nonsense probably null
R0126:Trrap UTSW 5 144805750 nonsense probably null
R0257:Trrap UTSW 5 144804235 missense probably benign 0.31
R0325:Trrap UTSW 5 144816395 missense probably benign 0.05
R0376:Trrap UTSW 5 144816339 missense probably benign 0.03
R0396:Trrap UTSW 5 144814556 missense probably damaging 0.99
R0448:Trrap UTSW 5 144839567 missense possibly damaging 0.66
R0454:Trrap UTSW 5 144846477 missense probably damaging 1.00
R0711:Trrap UTSW 5 144853499 missense probably damaging 1.00
R0827:Trrap UTSW 5 144814830 missense probably benign 0.00
R1005:Trrap UTSW 5 144805727 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1179:Trrap UTSW 5 144777939 missense possibly damaging 0.94
R1218:Trrap UTSW 5 144816409 missense probably damaging 1.00
R1264:Trrap UTSW 5 144789599 splice site probably benign
R1374:Trrap UTSW 5 144846618 missense probably damaging 1.00
R1401:Trrap UTSW 5 144857422 missense possibly damaging 0.93
R1480:Trrap UTSW 5 144818313 missense probably benign
R1538:Trrap UTSW 5 144837202 missense possibly damaging 0.65
R1751:Trrap UTSW 5 144814575 critical splice donor site probably null
R1779:Trrap UTSW 5 144828590 missense probably benign 0.01
R1782:Trrap UTSW 5 144822703 missense possibly damaging 0.93
R1792:Trrap UTSW 5 144853586 missense possibly damaging 0.87
R1861:Trrap UTSW 5 144815917 splice site probably null
R1902:Trrap UTSW 5 144816053 missense probably damaging 1.00
R1903:Trrap UTSW 5 144816053 missense probably damaging 1.00
R2021:Trrap UTSW 5 144853488 missense possibly damaging 0.94
R2026:Trrap UTSW 5 144803044 missense possibly damaging 0.86
R2036:Trrap UTSW 5 144828562 missense probably benign 0.08
R2099:Trrap UTSW 5 144782239 missense possibly damaging 0.46
R2108:Trrap UTSW 5 144825874 missense probably benign 0.01
R2113:Trrap UTSW 5 144844211 missense probably damaging 1.00
R2174:Trrap UTSW 5 144821855 missense probably benign 0.40
R2442:Trrap UTSW 5 144817966 missense probably damaging 1.00
R2568:Trrap UTSW 5 144843369 critical splice donor site probably null
R3442:Trrap UTSW 5 144792252 missense probably benign 0.03
R3853:Trrap UTSW 5 144792165 missense probably damaging 1.00
R4401:Trrap UTSW 5 144843318 missense possibly damaging 0.60
R4493:Trrap UTSW 5 144831048 missense probably benign 0.21
R4524:Trrap UTSW 5 144825321 missense probably benign 0.38
R4569:Trrap UTSW 5 144792118 missense probably benign 0.13
R4672:Trrap UTSW 5 144785480 missense probably damaging 0.97
R4732:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4733:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4791:Trrap UTSW 5 144803277 missense probably damaging 1.00
R4795:Trrap UTSW 5 144832488 missense probably benign 0.06
R4827:Trrap UTSW 5 144800948 missense probably benign 0.02
R4839:Trrap UTSW 5 144845592 missense probably damaging 1.00
R4915:Trrap UTSW 5 144805735 missense probably damaging 0.99
R4951:Trrap UTSW 5 144805720 missense possibly damaging 0.65
R4959:Trrap UTSW 5 144856960 missense probably damaging 1.00
R5049:Trrap UTSW 5 144826717 missense probably damaging 1.00
R5074:Trrap UTSW 5 144851179 missense probably damaging 1.00
R5236:Trrap UTSW 5 144817786 missense probably benign 0.07
R5281:Trrap UTSW 5 144813503 missense probably benign 0.13
R5322:Trrap UTSW 5 144844224 missense probably damaging 1.00
R5457:Trrap UTSW 5 144849977 missense probably damaging 1.00
R5590:Trrap UTSW 5 144782265 missense probably benign 0.05
R5799:Trrap UTSW 5 144830945 missense probably benign
R5885:Trrap UTSW 5 144794793 missense probably damaging 1.00
R5905:Trrap UTSW 5 144849920 missense possibly damaging 0.95
R5908:Trrap UTSW 5 144786708 missense probably damaging 0.96
R5956:Trrap UTSW 5 144807391 splice site silent
R5992:Trrap UTSW 5 144810184 missense probably benign 0.00
R6017:Trrap UTSW 5 144844241 missense probably damaging 1.00
R6029:Trrap UTSW 5 144817679 missense possibly damaging 0.94
R6029:Trrap UTSW 5 144825914 missense possibly damaging 0.75
R6117:Trrap UTSW 5 144802961 missense possibly damaging 0.78
R6166:Trrap UTSW 5 144781981 missense possibly damaging 0.66
R6234:Trrap UTSW 5 144839713 intron probably null
R6288:Trrap UTSW 5 144811992 missense probably damaging 1.00
R6290:Trrap UTSW 5 144805018 missense probably damaging 1.00
R6316:Trrap UTSW 5 144813526 missense probably benign 0.02
R6398:Trrap UTSW 5 144790870 missense possibly damaging 0.83
R6413:Trrap UTSW 5 144784046 missense possibly damaging 0.83
R6499:Trrap UTSW 5 144857002 missense probably damaging 1.00
R6529:Trrap UTSW 5 144834204 missense probably benign 0.06
R6574:Trrap UTSW 5 144815550 critical splice donor site probably null
R6631:Trrap UTSW 5 144771650 missense possibly damaging 0.94
R6727:Trrap UTSW 5 144856950 missense probably damaging 1.00
R6776:Trrap UTSW 5 144851256 nonsense probably null
R6914:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6942:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6945:Trrap UTSW 5 144790855 missense possibly damaging 0.66
R7023:Trrap UTSW 5 144792154 missense possibly damaging 0.64
R7107:Trrap UTSW 5 144797135 missense probably benign 0.05
R7139:Trrap UTSW 5 144803178 missense possibly damaging 0.65
R7148:Trrap UTSW 5 144821803 missense possibly damaging 0.77
R7167:Trrap UTSW 5 144839614 missense probably benign 0.39
R7171:Trrap UTSW 5 144794049 missense probably damaging 1.00
R7205:Trrap UTSW 5 144842707 missense possibly damaging 0.94
R7215:Trrap UTSW 5 144797135 missense probably benign 0.05
R7255:Trrap UTSW 5 144858954 missense probably damaging 1.00
R7261:Trrap UTSW 5 144845477 missense possibly damaging 0.67
R7264:Trrap UTSW 5 144814523 missense probably benign 0.05
R7372:Trrap UTSW 5 144789398 missense probably benign
R7447:Trrap UTSW 5 144839474 missense probably damaging 0.97
R7449:Trrap UTSW 5 144851209 missense probably damaging 1.00
X0060:Trrap UTSW 5 144843361 missense probably damaging 0.96
Z1088:Trrap UTSW 5 144834197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCCCACAGATACTCACATGG -3'
(R):5'- ACGGTTTCAACTGGGATAGG -3'

Sequencing Primer
(F):5'- CTCTTTAAAGGAGGCAGTG -3'
(R):5'- CTAATACTGGTGTGGAAAACCCTG -3'
Posted On2014-06-23