Incidental Mutation 'R1859:Olfr45'
ID204216
Institutional Source Beutler Lab
Gene Symbol Olfr45
Ensembl Gene ENSMUSG00000066122
Gene Nameolfactory receptor 45
SynonymsIB6, GA_x6K02T2PBJ9-42837030-42837962, MOR253-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1859 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140681951-140696845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140691658 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 251 (V251E)
Ref Sequence ENSEMBL: ENSMUSP00000149309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084454] [ENSMUST00000210241] [ENSMUST00000214637]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084454
AA Change: V251E

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081492
Gene: ENSMUSG00000066122
AA Change: V251E

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.8e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 176 1.2e-7 PFAM
Pfam:7tm_1 42 291 3.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210241
AA Change: V251E
Predicted Effect possibly damaging
Transcript: ENSMUST00000214637
AA Change: V251E

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,670,834 probably benign Het
9930021J03Rik A C 19: 29,754,923 C230G possibly damaging Het
Adcy10 A G 1: 165,521,961 E467G probably damaging Het
Alkbh8 A G 9: 3,385,499 D597G probably benign Het
Alpk1 T A 3: 127,681,100 H418L possibly damaging Het
Ano5 G T 7: 51,546,833 V138L probably damaging Het
Aspg T A 12: 112,121,172 I319K possibly damaging Het
Atp9b T C 18: 80,749,920 T970A possibly damaging Het
C4b T A 17: 34,735,553 M881L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdca5 T C 19: 6,090,094 V95A possibly damaging Het
Cds2 A G 2: 132,302,195 Y297C probably damaging Het
Celsr2 C T 3: 108,396,630 G2371S probably damaging Het
Chd5 T A 4: 152,380,523 I1557N probably benign Het
Cntn5 C T 9: 9,972,834 E266K probably damaging Het
Crtam G A 9: 40,973,604 T363M possibly damaging Het
Dnah2 A G 11: 69,437,886 S3298P probably damaging Het
Dok1 A T 6: 83,032,245 Y209N probably damaging Het
Dpp10 T C 1: 123,353,604 D561G possibly damaging Het
Drosha A G 15: 12,878,718 K710R probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Ercc6 T C 14: 32,526,778 S429P probably damaging Het
Fam135a A T 1: 24,030,225 V521E probably damaging Het
Fbxl7 A T 15: 26,543,193 L456Q probably damaging Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Foxc2 G T 8: 121,116,625 R4L probably damaging Het
Glyctk C T 9: 106,157,532 V112I probably benign Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Guf1 G T 5: 69,568,460 G481* probably null Het
Heatr1 T C 13: 12,403,159 L324S probably damaging Het
Hectd1 A G 12: 51,806,567 L57P probably damaging Het
Hmcn1 A T 1: 150,657,193 C3080S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifit1 T A 19: 34,647,544 F27I probably benign Het
Ift20 G T 11: 78,540,034 E68* probably null Het
Itsn1 A G 16: 91,889,154 probably benign Het
Ksr2 T A 5: 117,414,941 L38Q probably damaging Het
Lama2 A T 10: 27,031,082 M2361K possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k9 A T 12: 81,724,482 S800R possibly damaging Het
Mef2a A G 7: 67,266,018 S179P probably damaging Het
Micall1 A G 15: 79,122,945 probably benign Het
Mpg A G 11: 32,231,957 probably null Het
Mpp7 A T 18: 7,350,967 *577K probably null Het
Msh4 G T 3: 153,905,880 H35Q probably benign Het
Mst1 G A 9: 108,084,346 V601I probably benign Het
Myh10 T A 11: 68,745,413 N246K probably benign Het
Myom3 C A 4: 135,779,396 N493K probably benign Het
Mypn T C 10: 63,146,190 D537G probably benign Het
Ncan A T 8: 70,115,348 M38K possibly damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nos1 A T 5: 117,905,462 N601Y possibly damaging Het
Nrxn2 G A 19: 6,488,795 V794I probably benign Het
Olfr1099 T C 2: 86,959,081 I126V probably damaging Het
Olfr1390 T C 11: 49,341,384 L284P probably damaging Het
Olfr1495 T A 19: 13,768,724 Y127* probably null Het
Olfr156 A T 4: 43,820,779 I194N possibly damaging Het
Parp4 T C 14: 56,648,915 V1817A unknown Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Ppp1r3c T C 19: 36,733,611 N253S probably damaging Het
Prdm5 A G 6: 65,831,279 I42V probably benign Het
Prom2 T G 2: 127,541,097 Q75P probably damaging Het
Ptpn23 T C 9: 110,388,870 D669G possibly damaging Het
Rag1 T C 2: 101,644,062 D245G probably benign Het
Rpl22l1 T A 3: 28,806,598 probably null Het
Sars2 T C 7: 28,744,312 V113A probably damaging Het
Sbno2 T A 10: 80,058,639 K1067* probably null Het
Sec61g A G 11: 16,506,371 probably null Het
Slc4a11 A T 2: 130,688,012 M282K probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Sparc A T 11: 55,406,508 probably null Het
Thra T A 11: 98,756,151 C33S probably damaging Het
Tmem2 T C 19: 21,847,977 V1213A possibly damaging Het
Trrap A T 5: 144,830,951 T2293S probably benign Het
Ttn T A 2: 76,894,645 probably benign Het
Vat1l T A 8: 114,271,301 V195E probably damaging Het
Vmn1r60 T A 7: 5,544,550 I184F possibly damaging Het
Wdfy4 A G 14: 33,103,983 I1192T probably damaging Het
Zbtb10 T C 3: 9,280,386 S737P possibly damaging Het
Zfp553 A G 7: 127,235,345 E24G probably benign Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Olfr45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr45 APN 7 140691436 missense probably damaging 1.00
IGL01434:Olfr45 APN 7 140691618 missense probably damaging 1.00
IGL01697:Olfr45 APN 7 140691652 missense possibly damaging 0.61
IGL02167:Olfr45 APN 7 140691751 missense probably damaging 0.98
IGL02388:Olfr45 APN 7 140691111 missense probably benign 0.00
IGL03054:Olfr45 UTSW 7 140691710 missense probably benign 0.10
R0107:Olfr45 UTSW 7 140691345 missense probably benign
R0403:Olfr45 UTSW 7 140691309 missense possibly damaging 0.80
R1344:Olfr45 UTSW 7 140691799 missense probably damaging 0.98
R2871:Olfr45 UTSW 7 140691285 missense possibly damaging 0.95
R2871:Olfr45 UTSW 7 140691285 missense possibly damaging 0.95
R3611:Olfr45 UTSW 7 140691100 missense probably benign 0.01
R3915:Olfr45 UTSW 7 140690975 missense probably benign
R4551:Olfr45 UTSW 7 140691742 missense probably damaging 1.00
R4552:Olfr45 UTSW 7 140691742 missense probably damaging 1.00
R4627:Olfr45 UTSW 7 140691378 missense probably benign 0.00
R4628:Olfr45 UTSW 7 140691378 missense probably benign 0.00
R4629:Olfr45 UTSW 7 140691378 missense probably benign 0.00
R4990:Olfr45 UTSW 7 140691447 missense probably damaging 0.99
R5503:Olfr45 UTSW 7 140691396 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTCATTCTGTGGACCCAAGG -3'
(R):5'- AGGCCAATATTCTGCCCAAGG -3'

Sequencing Primer
(F):5'- AAGGTCATCACCCACTTCTTCTGTG -3'
(R):5'- AGGCAAGCTTGACATCCTTG -3'
Posted On2014-06-23