Incidental Mutation 'R1859:Mst1'
ID204229
Institutional Source Beutler Lab
Gene Symbol Mst1
Ensembl Gene ENSMUSG00000032591
Gene Namemacrophage stimulating 1 (hepatocyte growth factor-like)
SynonymsD9H3F15S2, DNF15S2h, D3F15S2h, Hgfl
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1859 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108080436-108085003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108084346 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 601 (V601I)
Ref Sequence ENSEMBL: ENSMUSP00000035211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162886] [ENSMUST00000178267] [ENSMUST00000193254]
Predicted Effect probably benign
Transcript: ENSMUST00000035211
AA Change: V601I

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591
AA Change: V601I

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081309
SMART Domains Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 2e-8 PFAM
Pfam:Abhydrolase_1 501 633 3.8e-9 PFAM
Pfam:Abhydrolase_5 501 708 5e-16 PFAM
Pfam:Peptidase_S9 516 732 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159372
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161253
AA Change: V14I

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably benign
Transcript: ENSMUST00000162886
AA Change: V592I

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591
AA Change: V592I

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192916
Predicted Effect probably benign
Transcript: ENSMUST00000193254
SMART Domains Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 4.8e-8 PFAM
Pfam:Abhydrolase_5 501 708 5.7e-16 PFAM
Pfam:Abhydrolase_6 503 714 6.2e-14 PFAM
Pfam:Peptidase_S9 515 732 1.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194915
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains four kringle domains and a serine protease domain, similar to that found in hepatic growth factor. Despite the presence of the serine protease domain, the encoded protein may not have any proteolytic activity. The receptor for this protein is RON tyrosine kinase, which upon activation stimulates ciliary motility of ciliated epithelial lung cells. This protein is secreted and cleaved to form an alpha chain and a beta chain bridged by disulfide bonds. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lipid-filled cytoplasmic vacuoles in hepatocytes throughout the liver lobules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,670,834 probably benign Het
9930021J03Rik A C 19: 29,754,923 C230G possibly damaging Het
Adcy10 A G 1: 165,521,961 E467G probably damaging Het
Alkbh8 A G 9: 3,385,499 D597G probably benign Het
Alpk1 T A 3: 127,681,100 H418L possibly damaging Het
Ano5 G T 7: 51,546,833 V138L probably damaging Het
Aspg T A 12: 112,121,172 I319K possibly damaging Het
Atp9b T C 18: 80,749,920 T970A possibly damaging Het
C4b T A 17: 34,735,553 M881L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdca5 T C 19: 6,090,094 V95A possibly damaging Het
Cds2 A G 2: 132,302,195 Y297C probably damaging Het
Celsr2 C T 3: 108,396,630 G2371S probably damaging Het
Chd5 T A 4: 152,380,523 I1557N probably benign Het
Cntn5 C T 9: 9,972,834 E266K probably damaging Het
Crtam G A 9: 40,973,604 T363M possibly damaging Het
Dnah2 A G 11: 69,437,886 S3298P probably damaging Het
Dok1 A T 6: 83,032,245 Y209N probably damaging Het
Dpp10 T C 1: 123,353,604 D561G possibly damaging Het
Drosha A G 15: 12,878,718 K710R probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Ercc6 T C 14: 32,526,778 S429P probably damaging Het
Fam135a A T 1: 24,030,225 V521E probably damaging Het
Fbxl7 A T 15: 26,543,193 L456Q probably damaging Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Foxc2 G T 8: 121,116,625 R4L probably damaging Het
Glyctk C T 9: 106,157,532 V112I probably benign Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Guf1 G T 5: 69,568,460 G481* probably null Het
Heatr1 T C 13: 12,403,159 L324S probably damaging Het
Hectd1 A G 12: 51,806,567 L57P probably damaging Het
Hmcn1 A T 1: 150,657,193 C3080S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifit1 T A 19: 34,647,544 F27I probably benign Het
Ift20 G T 11: 78,540,034 E68* probably null Het
Itsn1 A G 16: 91,889,154 probably benign Het
Ksr2 T A 5: 117,414,941 L38Q probably damaging Het
Lama2 A T 10: 27,031,082 M2361K possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k9 A T 12: 81,724,482 S800R possibly damaging Het
Mef2a A G 7: 67,266,018 S179P probably damaging Het
Micall1 A G 15: 79,122,945 probably benign Het
Mpg A G 11: 32,231,957 probably null Het
Mpp7 A T 18: 7,350,967 *577K probably null Het
Msh4 G T 3: 153,905,880 H35Q probably benign Het
Myh10 T A 11: 68,745,413 N246K probably benign Het
Myom3 C A 4: 135,779,396 N493K probably benign Het
Mypn T C 10: 63,146,190 D537G probably benign Het
Ncan A T 8: 70,115,348 M38K possibly damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nos1 A T 5: 117,905,462 N601Y possibly damaging Het
Nrxn2 G A 19: 6,488,795 V794I probably benign Het
Olfr1099 T C 2: 86,959,081 I126V probably damaging Het
Olfr1390 T C 11: 49,341,384 L284P probably damaging Het
Olfr1495 T A 19: 13,768,724 Y127* probably null Het
Olfr156 A T 4: 43,820,779 I194N possibly damaging Het
Olfr45 T A 7: 140,691,658 V251E possibly damaging Het
Parp4 T C 14: 56,648,915 V1817A unknown Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Ppp1r3c T C 19: 36,733,611 N253S probably damaging Het
Prdm5 A G 6: 65,831,279 I42V probably benign Het
Prom2 T G 2: 127,541,097 Q75P probably damaging Het
Ptpn23 T C 9: 110,388,870 D669G possibly damaging Het
Rag1 T C 2: 101,644,062 D245G probably benign Het
Rpl22l1 T A 3: 28,806,598 probably null Het
Sars2 T C 7: 28,744,312 V113A probably damaging Het
Sbno2 T A 10: 80,058,639 K1067* probably null Het
Sec61g A G 11: 16,506,371 probably null Het
Slc4a11 A T 2: 130,688,012 M282K probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Sparc A T 11: 55,406,508 probably null Het
Thra T A 11: 98,756,151 C33S probably damaging Het
Tmem2 T C 19: 21,847,977 V1213A possibly damaging Het
Trrap A T 5: 144,830,951 T2293S probably benign Het
Ttn T A 2: 76,894,645 probably benign Het
Vat1l T A 8: 114,271,301 V195E probably damaging Het
Vmn1r60 T A 7: 5,544,550 I184F possibly damaging Het
Wdfy4 A G 14: 33,103,983 I1192T probably damaging Het
Zbtb10 T C 3: 9,280,386 S737P possibly damaging Het
Zfp553 A G 7: 127,235,345 E24G probably benign Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Mst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Mst1 APN 9 108081601 missense probably benign 0.03
IGL01380:Mst1 APN 9 108084588 missense probably damaging 1.00
IGL01420:Mst1 APN 9 108082828 missense probably damaging 0.99
IGL02931:Mst1 APN 9 108084642 intron probably null
IGL03059:Mst1 APN 9 108084813 missense probably damaging 1.00
IGL03275:Mst1 APN 9 108084388 missense possibly damaging 0.70
R0319:Mst1 UTSW 9 108082513 missense probably benign 0.05
R0361:Mst1 UTSW 9 108084897 missense probably damaging 0.98
R0412:Mst1 UTSW 9 108083594 missense probably benign 0.06
R0569:Mst1 UTSW 9 108082301 missense probably damaging 0.98
R1432:Mst1 UTSW 9 108084204 missense probably benign 0.01
R1483:Mst1 UTSW 9 108081650 missense probably benign 0.03
R2187:Mst1 UTSW 9 108084340 missense possibly damaging 0.63
R2393:Mst1 UTSW 9 108082952 critical splice donor site probably null
R3522:Mst1 UTSW 9 108081503 unclassified probably benign
R3916:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3917:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3945:Mst1 UTSW 9 108084853 missense probably damaging 1.00
R4006:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4007:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4737:Mst1 UTSW 9 108080521 missense probably benign 0.00
R4756:Mst1 UTSW 9 108083627 missense probably benign 0.28
R5047:Mst1 UTSW 9 108084309 missense probably benign 0.17
R5113:Mst1 UTSW 9 108082247 missense probably damaging 1.00
R5278:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5279:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5402:Mst1 UTSW 9 108084209 critical splice donor site probably null
R5677:Mst1 UTSW 9 108081286 missense probably damaging 0.98
R5712:Mst1 UTSW 9 108082908 missense probably damaging 1.00
R6717:Mst1 UTSW 9 108080575 intron probably null
R7059:Mst1 UTSW 9 108084064 missense probably benign 0.44
R7131:Mst1 UTSW 9 108084931 missense probably null 0.07
R7139:Mst1 UTSW 9 108082828 missense probably damaging 0.99
R7219:Mst1 UTSW 9 108081286 missense probably damaging 0.99
X0028:Mst1 UTSW 9 108082217 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCAGCTTGTTCTGCTCAAG -3'
(R):5'- CCTGGGTGCATATCTCACTC -3'

Sequencing Primer
(F):5'- TCTGCTCAAGCTGGAGAGG -3'
(R):5'- GATGACATTCATCGAGGCCACATG -3'
Posted On2014-06-23