Incidental Mutation 'R1859:Ptpn23'
ID204230
Institutional Source Beutler Lab
Gene Symbol Ptpn23
Ensembl Gene ENSMUSG00000036057
Gene Nameprotein tyrosine phosphatase, non-receptor type 23
SynonymsPTP-TD14
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1859 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110385082-110408213 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110388870 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 669 (D669G)
Ref Sequence ENSEMBL: ENSMUSP00000039580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040021] [ENSMUST00000098350]
PDB Structure
MONA SH3C IN COMPLEX [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040021
AA Change: D669G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039580
Gene: ENSMUSG00000036057
AA Change: D669G

DomainStartEndE-ValueType
BRO1 8 384 5.94e-159 SMART
Pfam:ALIX_LYPXL_bnd 416 704 1.4e-64 PFAM
low complexity region 715 728 N/A INTRINSIC
low complexity region 774 785 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 905 928 N/A INTRINSIC
internal_repeat_1 929 942 8.2e-5 PROSPERO
internal_repeat_1 943 956 8.2e-5 PROSPERO
low complexity region 977 1018 N/A INTRINSIC
low complexity region 1040 1061 N/A INTRINSIC
low complexity region 1088 1106 N/A INTRINSIC
low complexity region 1128 1160 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
low complexity region 1225 1235 N/A INTRINSIC
PTPc 1246 1510 1.28e-92 SMART
low complexity region 1576 1587 N/A INTRINSIC
low complexity region 1589 1643 N/A INTRINSIC
Blast:PTPc 1644 1673 9e-8 BLAST
low complexity region 1675 1689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098350
SMART Domains Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
Pfam:Patched 279 504 4.7e-24 PFAM
Pfam:Sterol-sensing 308 459 7.6e-54 PFAM
transmembrane domain 515 534 N/A INTRINSIC
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 741 751 N/A INTRINSIC
WD40 765 802 1.79e-1 SMART
low complexity region 847 865 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
WD40 953 990 9.86e1 SMART
low complexity region 1050 1060 N/A INTRINSIC
WD40 1062 1102 4.18e-2 SMART
WD40 1105 1143 5.64e-8 SMART
WD40 1147 1183 2.4e-1 SMART
WD40 1186 1223 2.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200278
Predicted Effect probably benign
Transcript: ENSMUST00000200531
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-receptor type protein-tyrosine phosphatase family. The encoded protein may be involved in the regulation of small nuclear ribonucleo protein assembly and pre-mRNA splicing by modifying the survival motor neuron (SMN) complex. The encoded protein additionally plays a role in ciliogenesis and is part of endosomal sorting complex required for transport (ESCRT) pathways. This gene may serve a tumor suppressor function. [provided by RefSeq, Jul 2016]
PHENOTYPE: Embryos homozygous for a gene trap allele are significantly growth retarded and fail to reach the E8.5 stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,670,834 probably benign Het
9930021J03Rik A C 19: 29,754,923 C230G possibly damaging Het
Adcy10 A G 1: 165,521,961 E467G probably damaging Het
Alkbh8 A G 9: 3,385,499 D597G probably benign Het
Alpk1 T A 3: 127,681,100 H418L possibly damaging Het
Ano5 G T 7: 51,546,833 V138L probably damaging Het
Aspg T A 12: 112,121,172 I319K possibly damaging Het
Atp9b T C 18: 80,749,920 T970A possibly damaging Het
C4b T A 17: 34,735,553 M881L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdca5 T C 19: 6,090,094 V95A possibly damaging Het
Cds2 A G 2: 132,302,195 Y297C probably damaging Het
Celsr2 C T 3: 108,396,630 G2371S probably damaging Het
Chd5 T A 4: 152,380,523 I1557N probably benign Het
Cntn5 C T 9: 9,972,834 E266K probably damaging Het
Crtam G A 9: 40,973,604 T363M possibly damaging Het
Dnah2 A G 11: 69,437,886 S3298P probably damaging Het
Dok1 A T 6: 83,032,245 Y209N probably damaging Het
Dpp10 T C 1: 123,353,604 D561G possibly damaging Het
Drosha A G 15: 12,878,718 K710R probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Ercc6 T C 14: 32,526,778 S429P probably damaging Het
Fam135a A T 1: 24,030,225 V521E probably damaging Het
Fbxl7 A T 15: 26,543,193 L456Q probably damaging Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Foxc2 G T 8: 121,116,625 R4L probably damaging Het
Glyctk C T 9: 106,157,532 V112I probably benign Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Guf1 G T 5: 69,568,460 G481* probably null Het
Heatr1 T C 13: 12,403,159 L324S probably damaging Het
Hectd1 A G 12: 51,806,567 L57P probably damaging Het
Hmcn1 A T 1: 150,657,193 C3080S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifit1 T A 19: 34,647,544 F27I probably benign Het
Ift20 G T 11: 78,540,034 E68* probably null Het
Itsn1 A G 16: 91,889,154 probably benign Het
Ksr2 T A 5: 117,414,941 L38Q probably damaging Het
Lama2 A T 10: 27,031,082 M2361K possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k9 A T 12: 81,724,482 S800R possibly damaging Het
Mef2a A G 7: 67,266,018 S179P probably damaging Het
Micall1 A G 15: 79,122,945 probably benign Het
Mpg A G 11: 32,231,957 probably null Het
Mpp7 A T 18: 7,350,967 *577K probably null Het
Msh4 G T 3: 153,905,880 H35Q probably benign Het
Mst1 G A 9: 108,084,346 V601I probably benign Het
Myh10 T A 11: 68,745,413 N246K probably benign Het
Myom3 C A 4: 135,779,396 N493K probably benign Het
Mypn T C 10: 63,146,190 D537G probably benign Het
Ncan A T 8: 70,115,348 M38K possibly damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nos1 A T 5: 117,905,462 N601Y possibly damaging Het
Nrxn2 G A 19: 6,488,795 V794I probably benign Het
Olfr1099 T C 2: 86,959,081 I126V probably damaging Het
Olfr1390 T C 11: 49,341,384 L284P probably damaging Het
Olfr1495 T A 19: 13,768,724 Y127* probably null Het
Olfr156 A T 4: 43,820,779 I194N possibly damaging Het
Olfr45 T A 7: 140,691,658 V251E possibly damaging Het
Parp4 T C 14: 56,648,915 V1817A unknown Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Ppp1r3c T C 19: 36,733,611 N253S probably damaging Het
Prdm5 A G 6: 65,831,279 I42V probably benign Het
Prom2 T G 2: 127,541,097 Q75P probably damaging Het
Rag1 T C 2: 101,644,062 D245G probably benign Het
Rpl22l1 T A 3: 28,806,598 probably null Het
Sars2 T C 7: 28,744,312 V113A probably damaging Het
Sbno2 T A 10: 80,058,639 K1067* probably null Het
Sec61g A G 11: 16,506,371 probably null Het
Slc4a11 A T 2: 130,688,012 M282K probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Sparc A T 11: 55,406,508 probably null Het
Thra T A 11: 98,756,151 C33S probably damaging Het
Tmem2 T C 19: 21,847,977 V1213A possibly damaging Het
Trrap A T 5: 144,830,951 T2293S probably benign Het
Ttn T A 2: 76,894,645 probably benign Het
Vat1l T A 8: 114,271,301 V195E probably damaging Het
Vmn1r60 T A 7: 5,544,550 I184F possibly damaging Het
Wdfy4 A G 14: 33,103,983 I1192T probably damaging Het
Zbtb10 T C 3: 9,280,386 S737P possibly damaging Het
Zfp553 A G 7: 127,235,345 E24G probably benign Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Ptpn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Ptpn23 APN 9 110388106 missense probably benign 0.00
IGL01462:Ptpn23 APN 9 110408107 missense probably benign 0.33
IGL01666:Ptpn23 APN 9 110386545 missense possibly damaging 0.95
IGL01757:Ptpn23 APN 9 110391636 missense probably damaging 1.00
IGL02402:Ptpn23 APN 9 110393713 missense possibly damaging 0.81
IGL02891:Ptpn23 APN 9 110388020 nonsense probably null
peony UTSW 9 110386507 missense probably damaging 0.97
FR4449:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4548:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4737:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4976:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
R0111:Ptpn23 UTSW 9 110385623 missense probably damaging 0.97
R0377:Ptpn23 UTSW 9 110388132 missense possibly damaging 0.73
R0432:Ptpn23 UTSW 9 110389010 critical splice donor site probably null
R0456:Ptpn23 UTSW 9 110389793 splice site probably null
R0457:Ptpn23 UTSW 9 110386293 missense possibly damaging 0.95
R0988:Ptpn23 UTSW 9 110388777 missense probably benign 0.02
R1072:Ptpn23 UTSW 9 110386595 missense probably benign 0.29
R1769:Ptpn23 UTSW 9 110391678 missense possibly damaging 0.89
R1891:Ptpn23 UTSW 9 110393800 missense possibly damaging 0.74
R1915:Ptpn23 UTSW 9 110386507 missense probably damaging 0.97
R1954:Ptpn23 UTSW 9 110386325 missense probably damaging 0.99
R2299:Ptpn23 UTSW 9 110392513 missense possibly damaging 0.72
R2431:Ptpn23 UTSW 9 110386279 nonsense probably null
R2445:Ptpn23 UTSW 9 110387632 missense possibly damaging 0.79
R3014:Ptpn23 UTSW 9 110389695 missense probably benign
R3820:Ptpn23 UTSW 9 110389794 unclassified probably benign
R3904:Ptpn23 UTSW 9 110389245 missense probably benign 0.11
R4441:Ptpn23 UTSW 9 110392725 missense probably benign 0.01
R4464:Ptpn23 UTSW 9 110386813 missense probably damaging 1.00
R4709:Ptpn23 UTSW 9 110388856 missense possibly damaging 0.86
R4810:Ptpn23 UTSW 9 110389136 missense possibly damaging 0.93
R4937:Ptpn23 UTSW 9 110392738 missense probably benign 0.09
R5023:Ptpn23 UTSW 9 110388556 missense probably benign 0.00
R5057:Ptpn23 UTSW 9 110388556 missense probably benign 0.00
R5065:Ptpn23 UTSW 9 110398188 missense possibly damaging 0.91
R5143:Ptpn23 UTSW 9 110385438 unclassified probably benign
R5370:Ptpn23 UTSW 9 110385701 missense possibly damaging 0.79
R5534:Ptpn23 UTSW 9 110392741 missense possibly damaging 0.95
R5715:Ptpn23 UTSW 9 110387075 missense probably damaging 1.00
R5914:Ptpn23 UTSW 9 110385443 unclassified probably benign
R6122:Ptpn23 UTSW 9 110387825 unclassified probably benign
R6155:Ptpn23 UTSW 9 110387781 unclassified probably benign
R6156:Ptpn23 UTSW 9 110387781 unclassified probably benign
R6296:Ptpn23 UTSW 9 110393826 missense probably damaging 0.96
R6755:Ptpn23 UTSW 9 110389787 missense probably damaging 0.98
R7018:Ptpn23 UTSW 9 110385816 missense possibly damaging 0.89
R7126:Ptpn23 UTSW 9 110388744 missense probably benign 0.00
R7181:Ptpn23 UTSW 9 110385257 missense unknown
X0062:Ptpn23 UTSW 9 110387707 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGCTCAACCTACAATGAAGC -3'
(R):5'- AGGTCTACCTGGAGCAGAAC -3'

Sequencing Primer
(F):5'- GGCTCAACCTACAATGAAGCCTAAAG -3'
(R):5'- CTGAGGCCAACGTGCAGTATG -3'
Posted On2014-06-23