Incidental Mutation 'R1859:Thra'
ID204245
Institutional Source Beutler Lab
Gene Symbol Thra
Ensembl Gene ENSMUSG00000058756
Gene Namethyroid hormone receptor alpha
SynonymsTR alpha 1, Thra2, Thra1, Rvr, TR alpha 2, c-erbAalpha, 6430529J03Rik, Erba, Nr1a1, T3Ralpha, T3R[a]
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R1859 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98740638-98769006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98756151 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 33 (C33S)
Ref Sequence ENSEMBL: ENSMUSP00000099428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064187] [ENSMUST00000103139] [ENSMUST00000124072] [ENSMUST00000153043]
Predicted Effect probably damaging
Transcript: ENSMUST00000064187
AA Change: C33S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068281
Gene: ENSMUSG00000058756
AA Change: C33S

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 1.43e-31 SMART
low complexity region 461 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103139
AA Change: C33S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099428
Gene: ENSMUSG00000058756
AA Change: C33S

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 7.26e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000124072
AA Change: C33S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115323
Gene: ENSMUSG00000058756
AA Change: C33S

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 2.36e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152195
Predicted Effect possibly damaging
Transcript: ENSMUST00000153043
AA Change: C33S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153468
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is one of several nuclear hormone receptors that bind thyroid hormones such as triiodothyronine and thyroxine with high affinity. The encoded protein is a transcription factor that can activate or repress transcription. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations in this gene result in diverse phenotypes depending on the location and severity of the mutation. Observed phenotypes may include alterations in thyroid physiology, intestinal remodeling, cerebellum development, bone growth, cardiac function, thermogenesis, and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,670,834 probably benign Het
9930021J03Rik A C 19: 29,754,923 C230G possibly damaging Het
Adcy10 A G 1: 165,521,961 E467G probably damaging Het
Alkbh8 A G 9: 3,385,499 D597G probably benign Het
Alpk1 T A 3: 127,681,100 H418L possibly damaging Het
Ano5 G T 7: 51,546,833 V138L probably damaging Het
Aspg T A 12: 112,121,172 I319K possibly damaging Het
Atp9b T C 18: 80,749,920 T970A possibly damaging Het
C4b T A 17: 34,735,553 M881L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdca5 T C 19: 6,090,094 V95A possibly damaging Het
Cds2 A G 2: 132,302,195 Y297C probably damaging Het
Celsr2 C T 3: 108,396,630 G2371S probably damaging Het
Chd5 T A 4: 152,380,523 I1557N probably benign Het
Cntn5 C T 9: 9,972,834 E266K probably damaging Het
Crtam G A 9: 40,973,604 T363M possibly damaging Het
Dnah2 A G 11: 69,437,886 S3298P probably damaging Het
Dok1 A T 6: 83,032,245 Y209N probably damaging Het
Dpp10 T C 1: 123,353,604 D561G possibly damaging Het
Drosha A G 15: 12,878,718 K710R probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Ercc6 T C 14: 32,526,778 S429P probably damaging Het
Fam135a A T 1: 24,030,225 V521E probably damaging Het
Fbxl7 A T 15: 26,543,193 L456Q probably damaging Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Foxc2 G T 8: 121,116,625 R4L probably damaging Het
Glyctk C T 9: 106,157,532 V112I probably benign Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Guf1 G T 5: 69,568,460 G481* probably null Het
Heatr1 T C 13: 12,403,159 L324S probably damaging Het
Hectd1 A G 12: 51,806,567 L57P probably damaging Het
Hmcn1 A T 1: 150,657,193 C3080S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifit1 T A 19: 34,647,544 F27I probably benign Het
Ift20 G T 11: 78,540,034 E68* probably null Het
Itsn1 A G 16: 91,889,154 probably benign Het
Ksr2 T A 5: 117,414,941 L38Q probably damaging Het
Lama2 A T 10: 27,031,082 M2361K possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k9 A T 12: 81,724,482 S800R possibly damaging Het
Mef2a A G 7: 67,266,018 S179P probably damaging Het
Micall1 A G 15: 79,122,945 probably benign Het
Mpg A G 11: 32,231,957 probably null Het
Mpp7 A T 18: 7,350,967 *577K probably null Het
Msh4 G T 3: 153,905,880 H35Q probably benign Het
Mst1 G A 9: 108,084,346 V601I probably benign Het
Myh10 T A 11: 68,745,413 N246K probably benign Het
Myom3 C A 4: 135,779,396 N493K probably benign Het
Mypn T C 10: 63,146,190 D537G probably benign Het
Ncan A T 8: 70,115,348 M38K possibly damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nos1 A T 5: 117,905,462 N601Y possibly damaging Het
Nrxn2 G A 19: 6,488,795 V794I probably benign Het
Olfr1099 T C 2: 86,959,081 I126V probably damaging Het
Olfr1390 T C 11: 49,341,384 L284P probably damaging Het
Olfr1495 T A 19: 13,768,724 Y127* probably null Het
Olfr156 A T 4: 43,820,779 I194N possibly damaging Het
Olfr45 T A 7: 140,691,658 V251E possibly damaging Het
Parp4 T C 14: 56,648,915 V1817A unknown Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Ppp1r3c T C 19: 36,733,611 N253S probably damaging Het
Prdm5 A G 6: 65,831,279 I42V probably benign Het
Prom2 T G 2: 127,541,097 Q75P probably damaging Het
Ptpn23 T C 9: 110,388,870 D669G possibly damaging Het
Rag1 T C 2: 101,644,062 D245G probably benign Het
Rpl22l1 T A 3: 28,806,598 probably null Het
Sars2 T C 7: 28,744,312 V113A probably damaging Het
Sbno2 T A 10: 80,058,639 K1067* probably null Het
Sec61g A G 11: 16,506,371 probably null Het
Slc4a11 A T 2: 130,688,012 M282K probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Sparc A T 11: 55,406,508 probably null Het
Tmem2 T C 19: 21,847,977 V1213A possibly damaging Het
Trrap A T 5: 144,830,951 T2293S probably benign Het
Ttn T A 2: 76,894,645 probably benign Het
Vat1l T A 8: 114,271,301 V195E probably damaging Het
Vmn1r60 T A 7: 5,544,550 I184F possibly damaging Het
Wdfy4 A G 14: 33,103,983 I1192T probably damaging Het
Zbtb10 T C 3: 9,280,386 S737P possibly damaging Het
Zfp553 A G 7: 127,235,345 E24G probably benign Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Thra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Thra APN 11 98762928 missense possibly damaging 0.90
IGL01544:Thra APN 11 98756928 missense possibly damaging 0.46
IGL02377:Thra APN 11 98761916 missense probably damaging 1.00
IGL02738:Thra APN 11 98764359 missense probably benign 0.40
IGL03111:Thra APN 11 98761029 unclassified probably benign
R0033:Thra UTSW 11 98764352 missense probably benign 0.00
R0033:Thra UTSW 11 98764352 missense probably benign 0.00
R0959:Thra UTSW 11 98753629 missense possibly damaging 0.94
R1659:Thra UTSW 11 98756979 missense probably damaging 0.99
R1839:Thra UTSW 11 98756143 missense probably benign 0.01
R1935:Thra UTSW 11 98763073 splice site probably benign
R1956:Thra UTSW 11 98763741 missense probably benign 0.03
R4584:Thra UTSW 11 98764484 missense probably benign 0.42
R4782:Thra UTSW 11 98756164 missense probably benign 0.01
R5414:Thra UTSW 11 98760957 missense probably benign 0.34
R5790:Thra UTSW 11 98762951 missense probably benign 0.20
R5927:Thra UTSW 11 98763688 missense possibly damaging 0.56
R7207:Thra UTSW 11 98760976 missense probably damaging 1.00
R7234:Thra UTSW 11 98763718 missense probably damaging 1.00
R7307:Thra UTSW 11 98764308 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GACCCTTTCCAAGCTTTGTCAG -3'
(R):5'- CCTCCTCAAAGGCCAGAATAGG -3'

Sequencing Primer
(F):5'- GCTTTGTCAGCTGATATAGGGG -3'
(R):5'- CTCCTCAAAGGCCAGAATAGGTTTTG -3'
Posted On2014-06-23