Incidental Mutation 'R1775:Rxra'
ID204284
Institutional Source Beutler Lab
Gene Symbol Rxra
Ensembl Gene ENSMUSG00000015846
Gene Nameretinoid X receptor alpha
SynonymsRXRalpha1, RXR alpha 1, 9530071D11Rik
MMRRC Submission 039806-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1775 (G1)
Quality Score222
Status Validated
Chromosome2
Chromosomal Location27676440-27762957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27756244 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 340 (D340E)
Ref Sequence ENSEMBL: ENSMUSP00000109567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077257] [ENSMUST00000100251] [ENSMUST00000113934] [ENSMUST00000166775]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077257
AA Change: D368E

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076491
Gene: ENSMUSG00000015846
AA Change: D368E

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 18 132 4.2e-42 PFAM
ZnF_C4 137 208 1.76e-40 SMART
Blast:HOLI 233 265 1e-8 BLAST
HOLI 275 434 1.62e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100251
AA Change: D340E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097822
Gene: ENSMUSG00000015846
AA Change: D340E

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 1 104 1.8e-38 PFAM
ZnF_C4 109 180 1.76e-40 SMART
Blast:HOLI 205 237 1e-8 BLAST
HOLI 247 406 1.62e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113934
AA Change: D340E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109567
Gene: ENSMUSG00000015846
AA Change: D340E

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 1 104 1.8e-38 PFAM
ZnF_C4 109 180 1.76e-40 SMART
Blast:HOLI 205 237 1e-8 BLAST
HOLI 247 406 1.62e-53 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166775
AA Change: D368E

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133044
Gene: ENSMUSG00000015846
AA Change: D368E

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 17 132 6.5e-41 PFAM
ZnF_C4 137 208 1.76e-40 SMART
Blast:HOLI 233 265 1e-8 BLAST
HOLI 275 434 1.62e-53 SMART
Meta Mutation Damage Score 0.408 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Null embryos have multiple organ defects and die of cardiac failure by E14.5. Gene ablation in liver, prostate, fat or epidermis tissue-specifically affects development, function and/or neoplasia. Hypomorphic mutants develop alopecia, progressively severe dermal cysts and late corneal opacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,222,142 S20P unknown Het
4921528I07Rik G A 9: 114,279,318 noncoding transcript Het
4930562C15Rik G A 16: 4,851,558 probably null Het
4933427I04Rik A G 4: 123,860,493 T67A possibly damaging Het
Abcc2 A T 19: 43,798,419 N160Y possibly damaging Het
Acaca A G 11: 84,300,422 D155G possibly damaging Het
Afg3l1 G A 8: 123,492,900 R389Q possibly damaging Het
Ank2 G A 3: 126,934,547 T799M probably benign Het
Anxa2 T C 9: 69,488,081 Y202H possibly damaging Het
Arhgef33 A G 17: 80,373,743 T771A probably benign Het
Atp12a T C 14: 56,372,589 V182A probably benign Het
Birc6 T C 17: 74,612,286 L210S probably damaging Het
Car3 A G 3: 14,864,432 T73A probably benign Het
Cd5l T C 3: 87,368,659 L312P probably damaging Het
Celf5 A G 10: 81,467,304 probably benign Het
Cep290 T A 10: 100,496,810 V257E probably damaging Het
Cntrob T C 11: 69,320,867 D177G possibly damaging Het
Copg2 A T 6: 30,810,336 F658I probably damaging Het
Csmd3 T C 15: 47,899,739 T1234A probably damaging Het
Dhx35 A G 2: 158,806,437 T72A probably damaging Het
Dmrtc2 A T 7: 24,874,367 H209L possibly damaging Het
Eml5 G T 12: 98,852,704 probably null Het
Evpl T C 11: 116,223,660 E1068G possibly damaging Het
Ezh2 A G 6: 47,576,660 M41T probably damaging Het
Fmo3 A G 1: 162,968,725 S93P possibly damaging Het
Gdi2 A G 13: 3,560,018 Y213C possibly damaging Het
Gpr15 A T 16: 58,718,558 I56K probably benign Het
Gria2 G T 3: 80,691,338 S796R probably benign Het
Hectd4 T A 5: 121,291,191 probably benign Het
Hgfac T C 5: 35,042,850 probably benign Het
Hspg2 C T 4: 137,520,156 R1200W probably damaging Het
Ift52 G A 2: 163,025,355 D78N possibly damaging Het
Iqca C A 1: 90,081,416 W415L probably damaging Het
Ism1 A T 2: 139,746,043 K236N probably damaging Het
Itgb6 C T 2: 60,672,644 W43* probably null Het
Kcnk18 T A 19: 59,235,341 I306N probably damaging Het
Kctd8 T C 5: 69,340,560 K248E probably damaging Het
Layn T A 9: 51,059,533 I237F probably benign Het
Lce3f C T 3: 92,992,941 P23L unknown Het
Lct A G 1: 128,300,301 F1152L probably damaging Het
Mxra8 T C 4: 155,843,074 I413T probably damaging Het
Nedd9 A G 13: 41,317,962 V187A probably benign Het
Net1 A G 13: 3,887,642 L207P probably damaging Het
Neurod1 G T 2: 79,454,437 P201T probably benign Het
Nlrp1b A G 11: 71,161,821 F927S probably damaging Het
Ntrk3 T A 7: 78,356,041 H524L possibly damaging Het
Nup98 A C 7: 102,134,937 S1063A probably benign Het
Olfr1036 G A 2: 86,074,760 V7I possibly damaging Het
Olfr1333 T A 4: 118,829,868 M191L probably benign Het
Olfr1447 C A 19: 12,901,235 V182F probably benign Het
Olfr215 T C 6: 116,582,964 probably benign Het
Olfr657 G A 7: 104,636,159 V162I probably benign Het
Olfr747 G T 14: 50,681,166 P156Q possibly damaging Het
Pdzd2 G A 15: 12,592,460 R33W probably damaging Het
Phf21a G A 2: 92,330,515 V243I probably damaging Het
Ppp1r12b A G 1: 134,893,348 probably null Het
Rexo5 T C 7: 119,845,411 V703A probably benign Het
Rgs4 A G 1: 169,745,278 S30P probably benign Het
Rrnad1 A G 3: 87,923,817 S404P probably damaging Het
Samhd1 A G 2: 157,107,547 V473A probably benign Het
Scn3a T A 2: 65,472,342 K1253N probably damaging Het
Scn7a T C 2: 66,680,955 N1207S probably benign Het
Sec24d T A 3: 123,336,517 I443N probably damaging Het
Sema4g T A 19: 44,999,242 probably null Het
Sema5b A G 16: 35,660,324 K787R probably benign Het
Serpinc1 A G 1: 160,989,647 N104D probably benign Het
Sfn T C 4: 133,601,231 H180R probably damaging Het
Slc22a6 G T 19: 8,619,107 probably null Het
Slc9a8 T C 2: 167,457,358 S217P probably benign Het
Smc6 A G 12: 11,309,269 N965D probably benign Het
Sod2 T A 17: 13,015,032 I177N probably damaging Het
Sp4 A T 12: 118,299,600 I237K probably damaging Het
Sulf2 T C 2: 166,079,612 K697R probably benign Het
Svs4 A T 2: 164,277,085 D110E unknown Het
Tas1r1 T A 4: 152,038,218 R57* probably null Het
Tlr5 T C 1: 182,973,722 I197T probably damaging Het
Tmc3 T C 7: 83,612,532 V606A probably benign Het
Tmem241 T A 18: 12,118,412 L37F probably damaging Het
Tmem59l A T 8: 70,486,253 N90K probably damaging Het
Tram1 A C 1: 13,576,456 probably benign Het
Trim15 T A 17: 36,865,169 H162L probably benign Het
Ttc28 T A 5: 111,276,811 Y1501N probably benign Het
Ttc34 T C 4: 154,862,214 V857A probably benign Het
Tulp4 A G 17: 6,139,046 T48A probably damaging Het
Usp9y T C Y: 1,368,089 E939G probably damaging Het
Utp20 A G 10: 88,770,808 I1634T probably benign Het
Vmn2r72 T C 7: 85,738,170 M729V probably benign Het
Vps13c C T 9: 67,881,447 T334M probably damaging Het
Wnk4 C G 11: 101,276,340 probably benign Het
Xpo1 A G 11: 23,271,193 N97D probably benign Het
Xpo4 A T 14: 57,603,672 F518Y probably benign Het
Zfp668 C T 7: 127,866,606 V469I possibly damaging Het
Zfp85 C A 13: 67,749,704 C83F probably damaging Het
Other mutations in Rxra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Rxra APN 2 27754241 missense probably damaging 1.00
IGL03006:Rxra APN 2 27759645 missense probably damaging 1.00
pinkie UTSW 2 27752334 missense probably damaging 0.98
R0265:Rxra UTSW 2 27752430 missense probably damaging 1.00
R0578:Rxra UTSW 2 27759570 missense probably damaging 1.00
R1555:Rxra UTSW 2 27748678 missense probably benign 0.00
R3725:Rxra UTSW 2 27754277 missense probably damaging 1.00
R3756:Rxra UTSW 2 27741911 missense probably damaging 1.00
R3804:Rxra UTSW 2 27756260 missense probably damaging 1.00
R3965:Rxra UTSW 2 27752306 splice site probably benign
R4490:Rxra UTSW 2 27741195 missense probably damaging 0.99
R4898:Rxra UTSW 2 27741183 missense probably damaging 1.00
R5154:Rxra UTSW 2 27757868 critical splice donor site probably null
R5651:Rxra UTSW 2 27737341 missense probably benign 0.25
R6880:Rxra UTSW 2 27748656 missense possibly damaging 0.64
R6913:Rxra UTSW 2 27741174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCTCACTTCCTGTGGAC -3'
(R):5'- TAGAGTGCCACTTGAGCCTC -3'

Sequencing Primer
(F):5'- ACTTCCTGTGGACTTGGCCAG -3'
(R):5'- TCTCCATTACATCTCCAGACAAGTGG -3'
Posted On2014-06-23