Incidental Mutation 'R1775:Phf21a'
ID204290
Institutional Source Beutler Lab
Gene Symbol Phf21a
Ensembl Gene ENSMUSG00000058318
Gene NamePHD finger protein 21A
SynonymsPFTF1, Bhc80, Braf35/HDAC complex (Bhc), 80kDa, D030065N23Rik
MMRRC Submission 039806-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1775 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location92093117-92364666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92330515 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 243 (V243I)
Ref Sequence ENSEMBL: ENSMUSP00000106925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044036] [ENSMUST00000068702] [ENSMUST00000090586] [ENSMUST00000111290] [ENSMUST00000111291] [ENSMUST00000111292] [ENSMUST00000111293] [ENSMUST00000111294] [ENSMUST00000111297] [ENSMUST00000159961]
Predicted Effect probably damaging
Transcript: ENSMUST00000044036
AA Change: V159I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038497
Gene: ENSMUSG00000058318
AA Change: V159I

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068702
AA Change: V158I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070649
Gene: ENSMUSG00000058318
AA Change: V158I

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090586
AA Change: V243I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088074
Gene: ENSMUSG00000058318
AA Change: V243I

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111290
AA Change: V243I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106921
Gene: ENSMUSG00000058318
AA Change: V243I

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 405 417 4.28e-1 SMART
low complexity region 424 436 N/A INTRINSIC
PHD 470 513 3.12e-15 SMART
RING 471 512 1.85e-1 SMART
coiled coil region 537 582 N/A INTRINSIC
low complexity region 630 650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111291
AA Change: V159I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106922
Gene: ENSMUSG00000058318
AA Change: V159I

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111292
AA Change: V158I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106923
Gene: ENSMUSG00000058318
AA Change: V158I

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111293
AA Change: V243I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106924
Gene: ENSMUSG00000058318
AA Change: V243I

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111294
AA Change: V243I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106925
Gene: ENSMUSG00000058318
AA Change: V243I

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
PHD 452 495 3.12e-15 SMART
RING 453 494 1.85e-1 SMART
coiled coil region 519 564 N/A INTRINSIC
low complexity region 612 632 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111297
AA Change: V242I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106928
Gene: ENSMUSG00000058318
AA Change: V242I

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
PHD 422 465 3.12e-15 SMART
RING 423 464 1.85e-1 SMART
coiled coil region 489 534 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159366
SMART Domains Protein: ENSMUSP00000124238
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 26 59 N/A INTRINSIC
low complexity region 83 127 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000159727
AA Change: V124I
SMART Domains Protein: ENSMUSP00000124845
Gene: ENSMUSG00000058318
AA Change: V124I

DomainStartEndE-ValueType
low complexity region 131 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159961
AA Change: V130I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123955
Gene: ENSMUSG00000058318
AA Change: V130I

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 57 100 N/A INTRINSIC
low complexity region 136 157 N/A INTRINSIC
AT_hook 321 333 4.28e-1 SMART
low complexity region 340 352 N/A INTRINSIC
PHD 386 429 3.12e-15 SMART
RING 387 428 1.85e-1 SMART
coiled coil region 453 498 N/A INTRINSIC
low complexity region 546 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161067
SMART Domains Protein: ENSMUSP00000124255
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
PHD 140 183 3.12e-15 SMART
RING 141 182 1.85e-1 SMART
Meta Mutation Damage Score 0.578 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The PHF21A gene encodes BHC80, a component of a BRAF35 (MIM 605535)/histone deacetylase (HDAC; see MIM 601241) complex (BHC) that mediates repression of neuron-specific genes through the cis-regulatory element known as repressor element-1 (RE1) or neural restrictive silencer (NRS) (Hakimi et al., 2002 [PubMed 12032298]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and insufficient milk-sucking behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,222,142 S20P unknown Het
4921528I07Rik G A 9: 114,279,318 noncoding transcript Het
4930562C15Rik G A 16: 4,851,558 probably null Het
4933427I04Rik A G 4: 123,860,493 T67A possibly damaging Het
Abcc2 A T 19: 43,798,419 N160Y possibly damaging Het
Acaca A G 11: 84,300,422 D155G possibly damaging Het
Afg3l1 G A 8: 123,492,900 R389Q possibly damaging Het
Ank2 G A 3: 126,934,547 T799M probably benign Het
Anxa2 T C 9: 69,488,081 Y202H possibly damaging Het
Arhgef33 A G 17: 80,373,743 T771A probably benign Het
Atp12a T C 14: 56,372,589 V182A probably benign Het
Birc6 T C 17: 74,612,286 L210S probably damaging Het
Car3 A G 3: 14,864,432 T73A probably benign Het
Cd5l T C 3: 87,368,659 L312P probably damaging Het
Celf5 A G 10: 81,467,304 probably benign Het
Cep290 T A 10: 100,496,810 V257E probably damaging Het
Cntrob T C 11: 69,320,867 D177G possibly damaging Het
Copg2 A T 6: 30,810,336 F658I probably damaging Het
Csmd3 T C 15: 47,899,739 T1234A probably damaging Het
Dhx35 A G 2: 158,806,437 T72A probably damaging Het
Dmrtc2 A T 7: 24,874,367 H209L possibly damaging Het
Eml5 G T 12: 98,852,704 probably null Het
Evpl T C 11: 116,223,660 E1068G possibly damaging Het
Ezh2 A G 6: 47,576,660 M41T probably damaging Het
Fmo3 A G 1: 162,968,725 S93P possibly damaging Het
Gdi2 A G 13: 3,560,018 Y213C possibly damaging Het
Gpr15 A T 16: 58,718,558 I56K probably benign Het
Gria2 G T 3: 80,691,338 S796R probably benign Het
Hectd4 T A 5: 121,291,191 probably benign Het
Hgfac T C 5: 35,042,850 probably benign Het
Hspg2 C T 4: 137,520,156 R1200W probably damaging Het
Ift52 G A 2: 163,025,355 D78N possibly damaging Het
Iqca C A 1: 90,081,416 W415L probably damaging Het
Ism1 A T 2: 139,746,043 K236N probably damaging Het
Itgb6 C T 2: 60,672,644 W43* probably null Het
Kcnk18 T A 19: 59,235,341 I306N probably damaging Het
Kctd8 T C 5: 69,340,560 K248E probably damaging Het
Layn T A 9: 51,059,533 I237F probably benign Het
Lce3f C T 3: 92,992,941 P23L unknown Het
Lct A G 1: 128,300,301 F1152L probably damaging Het
Mxra8 T C 4: 155,843,074 I413T probably damaging Het
Nedd9 A G 13: 41,317,962 V187A probably benign Het
Net1 A G 13: 3,887,642 L207P probably damaging Het
Neurod1 G T 2: 79,454,437 P201T probably benign Het
Nlrp1b A G 11: 71,161,821 F927S probably damaging Het
Ntrk3 T A 7: 78,356,041 H524L possibly damaging Het
Nup98 A C 7: 102,134,937 S1063A probably benign Het
Olfr1036 G A 2: 86,074,760 V7I possibly damaging Het
Olfr1333 T A 4: 118,829,868 M191L probably benign Het
Olfr1447 C A 19: 12,901,235 V182F probably benign Het
Olfr215 T C 6: 116,582,964 probably benign Het
Olfr657 G A 7: 104,636,159 V162I probably benign Het
Olfr747 G T 14: 50,681,166 P156Q possibly damaging Het
Pdzd2 G A 15: 12,592,460 R33W probably damaging Het
Ppp1r12b A G 1: 134,893,348 probably null Het
Rexo5 T C 7: 119,845,411 V703A probably benign Het
Rgs4 A G 1: 169,745,278 S30P probably benign Het
Rrnad1 A G 3: 87,923,817 S404P probably damaging Het
Rxra C A 2: 27,756,244 D340E probably damaging Het
Samhd1 A G 2: 157,107,547 V473A probably benign Het
Scn3a T A 2: 65,472,342 K1253N probably damaging Het
Scn7a T C 2: 66,680,955 N1207S probably benign Het
Sec24d T A 3: 123,336,517 I443N probably damaging Het
Sema4g T A 19: 44,999,242 probably null Het
Sema5b A G 16: 35,660,324 K787R probably benign Het
Serpinc1 A G 1: 160,989,647 N104D probably benign Het
Sfn T C 4: 133,601,231 H180R probably damaging Het
Slc22a6 G T 19: 8,619,107 probably null Het
Slc9a8 T C 2: 167,457,358 S217P probably benign Het
Smc6 A G 12: 11,309,269 N965D probably benign Het
Sod2 T A 17: 13,015,032 I177N probably damaging Het
Sp4 A T 12: 118,299,600 I237K probably damaging Het
Sulf2 T C 2: 166,079,612 K697R probably benign Het
Svs4 A T 2: 164,277,085 D110E unknown Het
Tas1r1 T A 4: 152,038,218 R57* probably null Het
Tlr5 T C 1: 182,973,722 I197T probably damaging Het
Tmc3 T C 7: 83,612,532 V606A probably benign Het
Tmem241 T A 18: 12,118,412 L37F probably damaging Het
Tmem59l A T 8: 70,486,253 N90K probably damaging Het
Tram1 A C 1: 13,576,456 probably benign Het
Trim15 T A 17: 36,865,169 H162L probably benign Het
Ttc28 T A 5: 111,276,811 Y1501N probably benign Het
Ttc34 T C 4: 154,862,214 V857A probably benign Het
Tulp4 A G 17: 6,139,046 T48A probably damaging Het
Usp9y T C Y: 1,368,089 E939G probably damaging Het
Utp20 A G 10: 88,770,808 I1634T probably benign Het
Vmn2r72 T C 7: 85,738,170 M729V probably benign Het
Vps13c C T 9: 67,881,447 T334M probably damaging Het
Wnk4 C G 11: 101,276,340 probably benign Het
Xpo1 A G 11: 23,271,193 N97D probably benign Het
Xpo4 A T 14: 57,603,672 F518Y probably benign Het
Zfp668 C T 7: 127,866,606 V469I possibly damaging Het
Zfp85 C A 13: 67,749,704 C83F probably damaging Het
Other mutations in Phf21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Phf21a APN 2 92348029 missense probably damaging 1.00
IGL00826:Phf21a APN 2 92344536 splice site probably benign
IGL01859:Phf21a APN 2 92328356 missense probably damaging 1.00
IGL02124:Phf21a APN 2 92349422 missense probably damaging 1.00
IGL02724:Phf21a APN 2 92360247 missense probably damaging 1.00
IGL03155:Phf21a APN 2 92320266 missense probably damaging 0.99
R0308:Phf21a UTSW 2 92330777 missense possibly damaging 0.86
R1251:Phf21a UTSW 2 92359199 missense probably benign 0.00
R1739:Phf21a UTSW 2 92360299 missense possibly damaging 0.95
R2013:Phf21a UTSW 2 92228483 critical splice donor site probably null
R2064:Phf21a UTSW 2 92327077 missense possibly damaging 0.47
R2073:Phf21a UTSW 2 92348036 missense probably damaging 1.00
R4698:Phf21a UTSW 2 92356952 missense probably damaging 1.00
R4901:Phf21a UTSW 2 92357001 nonsense probably null
R5055:Phf21a UTSW 2 92351856 missense probably damaging 1.00
R5249:Phf21a UTSW 2 92228477 missense probably damaging 1.00
R5401:Phf21a UTSW 2 92351752 missense possibly damaging 0.71
R5770:Phf21a UTSW 2 92351854 missense possibly damaging 0.52
R5969:Phf21a UTSW 2 92221611 missense probably damaging 0.98
R6008:Phf21a UTSW 2 92351752 missense possibly damaging 0.71
R6012:Phf21a UTSW 2 92351775 missense probably damaging 1.00
R6128:Phf21a UTSW 2 92351608 critical splice acceptor site probably null
R6354:Phf21a UTSW 2 92348937 missense probably damaging 1.00
R7075:Phf21a UTSW 2 92360379 nonsense probably null
R7117:Phf21a UTSW 2 92359157 missense not run
Predicted Primers PCR Primer
(F):5'- CAACAAGGTCTTGCTGCTGTATC -3'
(R):5'- GTCCATTGACAACACGGACAGG -3'

Sequencing Primer
(F):5'- CGGATTTCTGAGTTCAAGGCTAACC -3'
(R):5'- ACAGGGTGGATGGAATTCTG -3'
Posted On2014-06-23