Incidental Mutation 'R1775:Ift52'
ID204296
Institutional Source Beutler Lab
Gene Symbol Ift52
Ensembl Gene ENSMUSG00000017858
Gene Nameintraflagellar transport 52
SynonymsNGD5
MMRRC Submission 039806-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1775 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location163017354-163046141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 163025355 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 78 (D78N)
Ref Sequence ENSEMBL: ENSMUSP00000018002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018002] [ENSMUST00000150396]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018002
AA Change: D78N

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018002
Gene: ENSMUSG00000017858
AA Change: D78N

DomainStartEndE-ValueType
Pfam:ABC_transp_aux 1 116 1.8e-13 PFAM
low complexity region 340 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125144
Predicted Effect probably benign
Transcript: ENSMUST00000150396
AA Change: D78N

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121943
Gene: ENSMUSG00000017858
AA Change: D78N

DomainStartEndE-ValueType
Pfam:ABC_transp_aux 3 117 4.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152201
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved proline-rich protein that is a component of the intraflagellar transport-B (IFT-B) core complex. The encoded protein is essential for the integrity of the IFT-B core complex, and for biosynthesis and maintenance of cilia. Mutations in this gene are associated with ciliopathy that affects the skeleton. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality between E9 and E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,222,142 S20P unknown Het
4921528I07Rik G A 9: 114,279,318 noncoding transcript Het
4930562C15Rik G A 16: 4,851,558 probably null Het
4933427I04Rik A G 4: 123,860,493 T67A possibly damaging Het
Abcc2 A T 19: 43,798,419 N160Y possibly damaging Het
Acaca A G 11: 84,300,422 D155G possibly damaging Het
Afg3l1 G A 8: 123,492,900 R389Q possibly damaging Het
Ank2 G A 3: 126,934,547 T799M probably benign Het
Anxa2 T C 9: 69,488,081 Y202H possibly damaging Het
Arhgef33 A G 17: 80,373,743 T771A probably benign Het
Atp12a T C 14: 56,372,589 V182A probably benign Het
Birc6 T C 17: 74,612,286 L210S probably damaging Het
Car3 A G 3: 14,864,432 T73A probably benign Het
Cd5l T C 3: 87,368,659 L312P probably damaging Het
Celf5 A G 10: 81,467,304 probably benign Het
Cep290 T A 10: 100,496,810 V257E probably damaging Het
Cntrob T C 11: 69,320,867 D177G possibly damaging Het
Copg2 A T 6: 30,810,336 F658I probably damaging Het
Csmd3 T C 15: 47,899,739 T1234A probably damaging Het
Dhx35 A G 2: 158,806,437 T72A probably damaging Het
Dmrtc2 A T 7: 24,874,367 H209L possibly damaging Het
Eml5 G T 12: 98,852,704 probably null Het
Evpl T C 11: 116,223,660 E1068G possibly damaging Het
Ezh2 A G 6: 47,576,660 M41T probably damaging Het
Fmo3 A G 1: 162,968,725 S93P possibly damaging Het
Gdi2 A G 13: 3,560,018 Y213C possibly damaging Het
Gpr15 A T 16: 58,718,558 I56K probably benign Het
Gria2 G T 3: 80,691,338 S796R probably benign Het
Hectd4 T A 5: 121,291,191 probably benign Het
Hgfac T C 5: 35,042,850 probably benign Het
Hspg2 C T 4: 137,520,156 R1200W probably damaging Het
Iqca C A 1: 90,081,416 W415L probably damaging Het
Ism1 A T 2: 139,746,043 K236N probably damaging Het
Itgb6 C T 2: 60,672,644 W43* probably null Het
Kcnk18 T A 19: 59,235,341 I306N probably damaging Het
Kctd8 T C 5: 69,340,560 K248E probably damaging Het
Layn T A 9: 51,059,533 I237F probably benign Het
Lce3f C T 3: 92,992,941 P23L unknown Het
Lct A G 1: 128,300,301 F1152L probably damaging Het
Mxra8 T C 4: 155,843,074 I413T probably damaging Het
Nedd9 A G 13: 41,317,962 V187A probably benign Het
Net1 A G 13: 3,887,642 L207P probably damaging Het
Neurod1 G T 2: 79,454,437 P201T probably benign Het
Nlrp1b A G 11: 71,161,821 F927S probably damaging Het
Ntrk3 T A 7: 78,356,041 H524L possibly damaging Het
Nup98 A C 7: 102,134,937 S1063A probably benign Het
Olfr1036 G A 2: 86,074,760 V7I possibly damaging Het
Olfr1333 T A 4: 118,829,868 M191L probably benign Het
Olfr1447 C A 19: 12,901,235 V182F probably benign Het
Olfr215 T C 6: 116,582,964 probably benign Het
Olfr657 G A 7: 104,636,159 V162I probably benign Het
Olfr747 G T 14: 50,681,166 P156Q possibly damaging Het
Pdzd2 G A 15: 12,592,460 R33W probably damaging Het
Phf21a G A 2: 92,330,515 V243I probably damaging Het
Ppp1r12b A G 1: 134,893,348 probably null Het
Rexo5 T C 7: 119,845,411 V703A probably benign Het
Rgs4 A G 1: 169,745,278 S30P probably benign Het
Rrnad1 A G 3: 87,923,817 S404P probably damaging Het
Rxra C A 2: 27,756,244 D340E probably damaging Het
Samhd1 A G 2: 157,107,547 V473A probably benign Het
Scn3a T A 2: 65,472,342 K1253N probably damaging Het
Scn7a T C 2: 66,680,955 N1207S probably benign Het
Sec24d T A 3: 123,336,517 I443N probably damaging Het
Sema4g T A 19: 44,999,242 probably null Het
Sema5b A G 16: 35,660,324 K787R probably benign Het
Serpinc1 A G 1: 160,989,647 N104D probably benign Het
Sfn T C 4: 133,601,231 H180R probably damaging Het
Slc22a6 G T 19: 8,619,107 probably null Het
Slc9a8 T C 2: 167,457,358 S217P probably benign Het
Smc6 A G 12: 11,309,269 N965D probably benign Het
Sod2 T A 17: 13,015,032 I177N probably damaging Het
Sp4 A T 12: 118,299,600 I237K probably damaging Het
Sulf2 T C 2: 166,079,612 K697R probably benign Het
Svs4 A T 2: 164,277,085 D110E unknown Het
Tas1r1 T A 4: 152,038,218 R57* probably null Het
Tlr5 T C 1: 182,973,722 I197T probably damaging Het
Tmc3 T C 7: 83,612,532 V606A probably benign Het
Tmem241 T A 18: 12,118,412 L37F probably damaging Het
Tmem59l A T 8: 70,486,253 N90K probably damaging Het
Tram1 A C 1: 13,576,456 probably benign Het
Trim15 T A 17: 36,865,169 H162L probably benign Het
Ttc28 T A 5: 111,276,811 Y1501N probably benign Het
Ttc34 T C 4: 154,862,214 V857A probably benign Het
Tulp4 A G 17: 6,139,046 T48A probably damaging Het
Usp9y T C Y: 1,368,089 E939G probably damaging Het
Utp20 A G 10: 88,770,808 I1634T probably benign Het
Vmn2r72 T C 7: 85,738,170 M729V probably benign Het
Vps13c C T 9: 67,881,447 T334M probably damaging Het
Wnk4 C G 11: 101,276,340 probably benign Het
Xpo1 A G 11: 23,271,193 N97D probably benign Het
Xpo4 A T 14: 57,603,672 F518Y probably benign Het
Zfp668 C T 7: 127,866,606 V469I possibly damaging Het
Zfp85 C A 13: 67,749,704 C83F probably damaging Het
Other mutations in Ift52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02006:Ift52 APN 2 163023369 missense probably benign 0.00
IGL02164:Ift52 APN 2 163025464 splice site probably null
IGL02657:Ift52 APN 2 163045215 missense probably damaging 1.00
IGL02876:Ift52 APN 2 163036707 missense probably benign 0.01
IGL03136:Ift52 APN 2 163025334 nonsense probably null
IGL03292:Ift52 APN 2 163023400 missense probably damaging 1.00
R1115:Ift52 UTSW 2 163029782 missense probably benign 0.34
R1502:Ift52 UTSW 2 163029862 critical splice donor site probably null
R2204:Ift52 UTSW 2 163031230 missense probably benign 0.07
R2259:Ift52 UTSW 2 163028093 missense probably benign 0.04
R2348:Ift52 UTSW 2 163045257 missense probably damaging 0.99
R4820:Ift52 UTSW 2 163031188 missense probably benign 0.06
R5464:Ift52 UTSW 2 163029815 missense probably benign 0.20
R7054:Ift52 UTSW 2 163029796 missense probably damaging 0.98
Z1088:Ift52 UTSW 2 163023358 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCGTCTCAGCTCCAAACTTTG -3'
(R):5'- GGTCTTCCCAGGATACCAGCA -3'

Sequencing Primer
(F):5'- CTGTAACTCCTTCCAGAGATAGATC -3'
(R):5'- TAAAGGTGCTTGCCATCACG -3'
Posted On2014-06-23