Incidental Mutation 'R1775:Sec24d'
ID204305
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene NameSec24 related gene family, member D (S. cerevisiae)
Synonyms2310020L09Rik, LOC383951
MMRRC Submission 039806-MU
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1775 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location123267455-123365641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123336517 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 443 (I443N)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
Predicted Effect probably damaging
Transcript: ENSMUST00000047923
AA Change: I443N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: I443N

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197291
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,222,142 S20P unknown Het
4921528I07Rik G A 9: 114,279,318 noncoding transcript Het
4930562C15Rik G A 16: 4,851,558 probably null Het
4933427I04Rik A G 4: 123,860,493 T67A possibly damaging Het
Abcc2 A T 19: 43,798,419 N160Y possibly damaging Het
Acaca A G 11: 84,300,422 D155G possibly damaging Het
Afg3l1 G A 8: 123,492,900 R389Q possibly damaging Het
Ank2 G A 3: 126,934,547 T799M probably benign Het
Anxa2 T C 9: 69,488,081 Y202H possibly damaging Het
Arhgef33 A G 17: 80,373,743 T771A probably benign Het
Atp12a T C 14: 56,372,589 V182A probably benign Het
Birc6 T C 17: 74,612,286 L210S probably damaging Het
Car3 A G 3: 14,864,432 T73A probably benign Het
Cd5l T C 3: 87,368,659 L312P probably damaging Het
Celf5 A G 10: 81,467,304 probably benign Het
Cep290 T A 10: 100,496,810 V257E probably damaging Het
Cntrob T C 11: 69,320,867 D177G possibly damaging Het
Copg2 A T 6: 30,810,336 F658I probably damaging Het
Csmd3 T C 15: 47,899,739 T1234A probably damaging Het
Dhx35 A G 2: 158,806,437 T72A probably damaging Het
Dmrtc2 A T 7: 24,874,367 H209L possibly damaging Het
Eml5 G T 12: 98,852,704 probably null Het
Evpl T C 11: 116,223,660 E1068G possibly damaging Het
Ezh2 A G 6: 47,576,660 M41T probably damaging Het
Fmo3 A G 1: 162,968,725 S93P possibly damaging Het
Gdi2 A G 13: 3,560,018 Y213C possibly damaging Het
Gpr15 A T 16: 58,718,558 I56K probably benign Het
Gria2 G T 3: 80,691,338 S796R probably benign Het
Hectd4 T A 5: 121,291,191 probably benign Het
Hgfac T C 5: 35,042,850 probably benign Het
Hspg2 C T 4: 137,520,156 R1200W probably damaging Het
Ift52 G A 2: 163,025,355 D78N possibly damaging Het
Iqca C A 1: 90,081,416 W415L probably damaging Het
Ism1 A T 2: 139,746,043 K236N probably damaging Het
Itgb6 C T 2: 60,672,644 W43* probably null Het
Kcnk18 T A 19: 59,235,341 I306N probably damaging Het
Kctd8 T C 5: 69,340,560 K248E probably damaging Het
Layn T A 9: 51,059,533 I237F probably benign Het
Lce3f C T 3: 92,992,941 P23L unknown Het
Lct A G 1: 128,300,301 F1152L probably damaging Het
Mxra8 T C 4: 155,843,074 I413T probably damaging Het
Nedd9 A G 13: 41,317,962 V187A probably benign Het
Net1 A G 13: 3,887,642 L207P probably damaging Het
Neurod1 G T 2: 79,454,437 P201T probably benign Het
Nlrp1b A G 11: 71,161,821 F927S probably damaging Het
Ntrk3 T A 7: 78,356,041 H524L possibly damaging Het
Nup98 A C 7: 102,134,937 S1063A probably benign Het
Olfr1036 G A 2: 86,074,760 V7I possibly damaging Het
Olfr1333 T A 4: 118,829,868 M191L probably benign Het
Olfr1447 C A 19: 12,901,235 V182F probably benign Het
Olfr215 T C 6: 116,582,964 probably benign Het
Olfr657 G A 7: 104,636,159 V162I probably benign Het
Olfr747 G T 14: 50,681,166 P156Q possibly damaging Het
Pdzd2 G A 15: 12,592,460 R33W probably damaging Het
Phf21a G A 2: 92,330,515 V243I probably damaging Het
Ppp1r12b A G 1: 134,893,348 probably null Het
Rexo5 T C 7: 119,845,411 V703A probably benign Het
Rgs4 A G 1: 169,745,278 S30P probably benign Het
Rrnad1 A G 3: 87,923,817 S404P probably damaging Het
Rxra C A 2: 27,756,244 D340E probably damaging Het
Samhd1 A G 2: 157,107,547 V473A probably benign Het
Scn3a T A 2: 65,472,342 K1253N probably damaging Het
Scn7a T C 2: 66,680,955 N1207S probably benign Het
Sema4g T A 19: 44,999,242 probably null Het
Sema5b A G 16: 35,660,324 K787R probably benign Het
Serpinc1 A G 1: 160,989,647 N104D probably benign Het
Sfn T C 4: 133,601,231 H180R probably damaging Het
Slc22a6 G T 19: 8,619,107 probably null Het
Slc9a8 T C 2: 167,457,358 S217P probably benign Het
Smc6 A G 12: 11,309,269 N965D probably benign Het
Sod2 T A 17: 13,015,032 I177N probably damaging Het
Sp4 A T 12: 118,299,600 I237K probably damaging Het
Sulf2 T C 2: 166,079,612 K697R probably benign Het
Svs4 A T 2: 164,277,085 D110E unknown Het
Tas1r1 T A 4: 152,038,218 R57* probably null Het
Tlr5 T C 1: 182,973,722 I197T probably damaging Het
Tmc3 T C 7: 83,612,532 V606A probably benign Het
Tmem241 T A 18: 12,118,412 L37F probably damaging Het
Tmem59l A T 8: 70,486,253 N90K probably damaging Het
Tram1 A C 1: 13,576,456 probably benign Het
Trim15 T A 17: 36,865,169 H162L probably benign Het
Ttc28 T A 5: 111,276,811 Y1501N probably benign Het
Ttc34 T C 4: 154,862,214 V857A probably benign Het
Tulp4 A G 17: 6,139,046 T48A probably damaging Het
Usp9y T C Y: 1,368,089 E939G probably damaging Het
Utp20 A G 10: 88,770,808 I1634T probably benign Het
Vmn2r72 T C 7: 85,738,170 M729V probably benign Het
Vps13c C T 9: 67,881,447 T334M probably damaging Het
Wnk4 C G 11: 101,276,340 probably benign Het
Xpo1 A G 11: 23,271,193 N97D probably benign Het
Xpo4 A T 14: 57,603,672 F518Y probably benign Het
Zfp668 C T 7: 127,866,606 V469I possibly damaging Het
Zfp85 C A 13: 67,749,704 C83F probably damaging Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATGGGAGGAGAGTCTCTG -3'
(R):5'- AACGATATTAATCAGCCAGTCTGC -3'

Sequencing Primer
(F):5'- AGAAAGTTCATGTCATAACGTGG -3'
(R):5'- GATATTAATCAGCCAGTCTGCTCAGC -3'
Posted On2014-06-23