Incidental Mutation 'R1775:Ezh2'
ID204323
Institutional Source Beutler Lab
Gene Symbol Ezh2
Ensembl Gene ENSMUSG00000029687
Gene Nameenhancer of zeste 2 polycomb repressive complex 2 subunit
SynonymsEnx-1, KMT6, Enx1h
MMRRC Submission 039806-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1775 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47530139-47595341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47576660 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 41 (M41T)
Ref Sequence ENSEMBL: ENSMUSP00000144780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081721] [ENSMUST00000092648] [ENSMUST00000114616] [ENSMUST00000114618] [ENSMUST00000133043] [ENSMUST00000204798]
Predicted Effect probably benign
Transcript: ENSMUST00000081721
AA Change: M41T

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080419
Gene: ENSMUSG00000029687
AA Change: M41T

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 6.1e-18 PFAM
SANT 159 250 9.7e-3 SMART
low complexity region 349 366 N/A INTRINSIC
low complexity region 385 409 N/A INTRINSIC
SANT 428 476 6.62e-1 SMART
CXC 555 592 1.05e-1 SMART
SET 612 733 4.15e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092648
AA Change: M41T

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090318
Gene: ENSMUSG00000029687
AA Change: M41T

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 6.9e-20 PFAM
SANT 159 250 9.7e-3 SMART
Blast:SET 272 333 3e-13 BLAST
low complexity region 349 366 N/A INTRINSIC
low complexity region 385 409 N/A INTRINSIC
SANT 428 476 6.62e-1 SMART
CXC 513 550 1.05e-1 SMART
SET 570 691 4.15e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114616
AA Change: M41T

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110263
Gene: ENSMUSG00000029687
AA Change: M41T

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 2.5e-20 PFAM
SANT 120 211 9.7e-3 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 346 370 N/A INTRINSIC
SANT 389 437 6.62e-1 SMART
CXC 516 553 1.05e-1 SMART
SET 573 694 4.15e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114618
AA Change: M41T

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110265
Gene: ENSMUSG00000029687
AA Change: M41T

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 7.4e-20 PFAM
SANT 150 241 9.7e-3 SMART
low complexity region 345 362 N/A INTRINSIC
low complexity region 381 405 N/A INTRINSIC
SANT 424 472 6.62e-1 SMART
CXC 551 588 1.05e-1 SMART
SET 608 729 4.15e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133043
AA Change: M41T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118663
Gene: ENSMUSG00000029687
AA Change: M41T

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 2.5e-20 PFAM
Blast:SANT 150 233 3e-43 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170327
Predicted Effect probably damaging
Transcript: ENSMUST00000204798
AA Change: M41T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144780
Gene: ENSMUSG00000029687
AA Change: M41T

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.4e-16 PFAM
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die prior to completing gastrulation. A conditional mutant with loss of expression in immune cells survives, but has defects in early B cell development and Igh rearrangement. Conditional loss of maternal protein results in severegrowth retardation of neonates. Conditional loss in oligodendrocytes affects oligodendrocyte maturation and delays subsequent myelinization of axons in the central nervous system by oligodendrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,222,142 S20P unknown Het
4921528I07Rik G A 9: 114,279,318 noncoding transcript Het
4930562C15Rik G A 16: 4,851,558 probably null Het
4933427I04Rik A G 4: 123,860,493 T67A possibly damaging Het
Abcc2 A T 19: 43,798,419 N160Y possibly damaging Het
Acaca A G 11: 84,300,422 D155G possibly damaging Het
Afg3l1 G A 8: 123,492,900 R389Q possibly damaging Het
Ank2 G A 3: 126,934,547 T799M probably benign Het
Anxa2 T C 9: 69,488,081 Y202H possibly damaging Het
Arhgef33 A G 17: 80,373,743 T771A probably benign Het
Atp12a T C 14: 56,372,589 V182A probably benign Het
Birc6 T C 17: 74,612,286 L210S probably damaging Het
Car3 A G 3: 14,864,432 T73A probably benign Het
Cd5l T C 3: 87,368,659 L312P probably damaging Het
Celf5 A G 10: 81,467,304 probably benign Het
Cep290 T A 10: 100,496,810 V257E probably damaging Het
Cntrob T C 11: 69,320,867 D177G possibly damaging Het
Copg2 A T 6: 30,810,336 F658I probably damaging Het
Csmd3 T C 15: 47,899,739 T1234A probably damaging Het
Dhx35 A G 2: 158,806,437 T72A probably damaging Het
Dmrtc2 A T 7: 24,874,367 H209L possibly damaging Het
Eml5 G T 12: 98,852,704 probably null Het
Evpl T C 11: 116,223,660 E1068G possibly damaging Het
Fmo3 A G 1: 162,968,725 S93P possibly damaging Het
Gdi2 A G 13: 3,560,018 Y213C possibly damaging Het
Gpr15 A T 16: 58,718,558 I56K probably benign Het
Gria2 G T 3: 80,691,338 S796R probably benign Het
Hectd4 T A 5: 121,291,191 probably benign Het
Hgfac T C 5: 35,042,850 probably benign Het
Hspg2 C T 4: 137,520,156 R1200W probably damaging Het
Ift52 G A 2: 163,025,355 D78N possibly damaging Het
Iqca C A 1: 90,081,416 W415L probably damaging Het
Ism1 A T 2: 139,746,043 K236N probably damaging Het
Itgb6 C T 2: 60,672,644 W43* probably null Het
Kcnk18 T A 19: 59,235,341 I306N probably damaging Het
Kctd8 T C 5: 69,340,560 K248E probably damaging Het
Layn T A 9: 51,059,533 I237F probably benign Het
Lce3f C T 3: 92,992,941 P23L unknown Het
Lct A G 1: 128,300,301 F1152L probably damaging Het
Mxra8 T C 4: 155,843,074 I413T probably damaging Het
Nedd9 A G 13: 41,317,962 V187A probably benign Het
Net1 A G 13: 3,887,642 L207P probably damaging Het
Neurod1 G T 2: 79,454,437 P201T probably benign Het
Nlrp1b A G 11: 71,161,821 F927S probably damaging Het
Ntrk3 T A 7: 78,356,041 H524L possibly damaging Het
Nup98 A C 7: 102,134,937 S1063A probably benign Het
Olfr1036 G A 2: 86,074,760 V7I possibly damaging Het
Olfr1333 T A 4: 118,829,868 M191L probably benign Het
Olfr1447 C A 19: 12,901,235 V182F probably benign Het
Olfr215 T C 6: 116,582,964 probably benign Het
Olfr657 G A 7: 104,636,159 V162I probably benign Het
Olfr747 G T 14: 50,681,166 P156Q possibly damaging Het
Pdzd2 G A 15: 12,592,460 R33W probably damaging Het
Phf21a G A 2: 92,330,515 V243I probably damaging Het
Ppp1r12b A G 1: 134,893,348 probably null Het
Rexo5 T C 7: 119,845,411 V703A probably benign Het
Rgs4 A G 1: 169,745,278 S30P probably benign Het
Rrnad1 A G 3: 87,923,817 S404P probably damaging Het
Rxra C A 2: 27,756,244 D340E probably damaging Het
Samhd1 A G 2: 157,107,547 V473A probably benign Het
Scn3a T A 2: 65,472,342 K1253N probably damaging Het
Scn7a T C 2: 66,680,955 N1207S probably benign Het
Sec24d T A 3: 123,336,517 I443N probably damaging Het
Sema4g T A 19: 44,999,242 probably null Het
Sema5b A G 16: 35,660,324 K787R probably benign Het
Serpinc1 A G 1: 160,989,647 N104D probably benign Het
Sfn T C 4: 133,601,231 H180R probably damaging Het
Slc22a6 G T 19: 8,619,107 probably null Het
Slc9a8 T C 2: 167,457,358 S217P probably benign Het
Smc6 A G 12: 11,309,269 N965D probably benign Het
Sod2 T A 17: 13,015,032 I177N probably damaging Het
Sp4 A T 12: 118,299,600 I237K probably damaging Het
Sulf2 T C 2: 166,079,612 K697R probably benign Het
Svs4 A T 2: 164,277,085 D110E unknown Het
Tas1r1 T A 4: 152,038,218 R57* probably null Het
Tlr5 T C 1: 182,973,722 I197T probably damaging Het
Tmc3 T C 7: 83,612,532 V606A probably benign Het
Tmem241 T A 18: 12,118,412 L37F probably damaging Het
Tmem59l A T 8: 70,486,253 N90K probably damaging Het
Tram1 A C 1: 13,576,456 probably benign Het
Trim15 T A 17: 36,865,169 H162L probably benign Het
Ttc28 T A 5: 111,276,811 Y1501N probably benign Het
Ttc34 T C 4: 154,862,214 V857A probably benign Het
Tulp4 A G 17: 6,139,046 T48A probably damaging Het
Usp9y T C Y: 1,368,089 E939G probably damaging Het
Utp20 A G 10: 88,770,808 I1634T probably benign Het
Vmn2r72 T C 7: 85,738,170 M729V probably benign Het
Vps13c C T 9: 67,881,447 T334M probably damaging Het
Wnk4 C G 11: 101,276,340 probably benign Het
Xpo1 A G 11: 23,271,193 N97D probably benign Het
Xpo4 A T 14: 57,603,672 F518Y probably benign Het
Zfp668 C T 7: 127,866,606 V469I possibly damaging Het
Zfp85 C A 13: 67,749,704 C83F probably damaging Het
Other mutations in Ezh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Ezh2 APN 6 47556055 nonsense probably null
IGL01932:Ezh2 APN 6 47532048 missense probably damaging 0.99
IGL02019:Ezh2 APN 6 47551901 splice site probably null
IGL02748:Ezh2 APN 6 47558239 missense probably damaging 1.00
IGL02749:Ezh2 APN 6 47533764 missense probably damaging 0.99
IGL03171:Ezh2 APN 6 47540781 nonsense probably null
R0417:Ezh2 UTSW 6 47551726 missense probably benign 0.00
R1256:Ezh2 UTSW 6 47541855 nonsense probably null
R1587:Ezh2 UTSW 6 47552490 critical splice acceptor site probably null
R1631:Ezh2 UTSW 6 47577658 start codon destroyed probably null 0.01
R1736:Ezh2 UTSW 6 47576660 missense probably damaging 1.00
R2076:Ezh2 UTSW 6 47576633 nonsense probably null
R2311:Ezh2 UTSW 6 47558260 missense probably damaging 1.00
R3751:Ezh2 UTSW 6 47556064 missense possibly damaging 0.94
R4016:Ezh2 UTSW 6 47544582 missense probably benign
R4119:Ezh2 UTSW 6 47544548 missense probably benign 0.00
R4214:Ezh2 UTSW 6 47533814 missense probably damaging 1.00
R4770:Ezh2 UTSW 6 47540696 missense probably damaging 1.00
R5133:Ezh2 UTSW 6 47540750 missense probably damaging 1.00
R5137:Ezh2 UTSW 6 47532080 splice site probably null
R5199:Ezh2 UTSW 6 47551725 missense probably benign 0.01
R5343:Ezh2 UTSW 6 47576615 missense probably damaging 1.00
R5584:Ezh2 UTSW 6 47532016 missense probably damaging 1.00
R5942:Ezh2 UTSW 6 47577582 missense possibly damaging 0.94
R6057:Ezh2 UTSW 6 47552423 missense probably damaging 1.00
X0021:Ezh2 UTSW 6 47554169 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATCCTGAAGTCTGTGAATTCTTC -3'
(R):5'- CCCTTTATTTACAAGCAAGTAGGAG -3'

Sequencing Primer
(F):5'- AGTCTGTGAATTCTTCTCAATAAGC -3'
(R):5'- CAAGCAAGTAGGAGTAATGTTTTTG -3'
Posted On2014-06-23