Incidental Mutation 'R1775:Evpl'
ID204352
Institutional Source Beutler Lab
Gene Symbol Evpl
Ensembl Gene ENSMUSG00000034282
Gene Nameenvoplakin
Synonyms210kDa protein
MMRRC Submission 039806-MU
Accession Numbers

Genbank: NM_025276; MGI: 107507

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1775 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116220559-116238077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116223660 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1068 (E1068G)
Ref Sequence ENSEMBL: ENSMUSP00000037850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037007] [ENSMUST00000174177]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037007
AA Change: E1068G

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037850
Gene: ENSMUSG00000034282
AA Change: E1068G

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Blast:SPEC 44 140 1e-16 BLAST
Blast:SPEC 140 226 4e-46 BLAST
SPEC 229 330 2.21e-6 SMART
Blast:SPEC 336 500 7e-68 BLAST
low complexity region 508 525 N/A INTRINSIC
Blast:SPEC 527 632 4e-41 BLAST
Blast:SPEC 635 746 5e-48 BLAST
Blast:SPEC 753 867 7e-49 BLAST
low complexity region 868 881 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
internal_repeat_2 1011 1030 6.54e-6 PROSPERO
internal_repeat_3 1012 1032 1.94e-5 PROSPERO
coiled coil region 1035 1077 N/A INTRINSIC
low complexity region 1131 1144 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
PLEC 1186 1227 1.48e2 SMART
low complexity region 1228 1242 N/A INTRINSIC
coiled coil region 1262 1366 N/A INTRINSIC
low complexity region 1398 1414 N/A INTRINSIC
internal_repeat_2 1457 1476 6.54e-6 PROSPERO
internal_repeat_3 1516 1536 1.94e-5 PROSPERO
low complexity region 1595 1617 N/A INTRINSIC
PLEC 1679 1714 9.19e-4 SMART
PLEC 1729 1764 4.53e1 SMART
low complexity region 1788 1800 N/A INTRINSIC
PLEC 1819 1856 1.41e-4 SMART
PLEC 1857 1894 5.4e-10 SMART
PLEC 1895 1932 2.7e-10 SMART
PLEC 1933 1970 1.21e-3 SMART
PLEC 1971 2008 1.16e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173567
Predicted Effect probably benign
Transcript: ENSMUST00000174177
SMART Domains Protein: ENSMUSP00000134251
Gene: ENSMUSG00000092300

DomainStartEndE-ValueType
S_TKc 4 285 4e-105 SMART
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plakin family of proteins that forms a component of desmosomes and the epidermal cornified envelope. This gene is located in the tylosis oesophageal cancer locus on chromosome 17q25, and its deletion is associated with both familial and sporadic forms of oesophageal squamous cell carcinoma. Patients suffering from the autoimmune mucocutaneous disorder, paraneoplastic pemphigus, develop antibodies against the encoded protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted deletion of this gene are viable and fertile. Surprisingly, cornified envelope assembly is not inhibited and adult homozygotes show no obvious pathological phenotype in skin or other epithelia, despite a slight delay in barrier acquisition during embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,222,142 S20P unknown Het
4921528I07Rik G A 9: 114,279,318 noncoding transcript Het
4930562C15Rik G A 16: 4,851,558 probably null Het
4933427I04Rik A G 4: 123,860,493 T67A possibly damaging Het
Abcc2 A T 19: 43,798,419 N160Y possibly damaging Het
Acaca A G 11: 84,300,422 D155G possibly damaging Het
Afg3l1 G A 8: 123,492,900 R389Q possibly damaging Het
Ank2 G A 3: 126,934,547 T799M probably benign Het
Anxa2 T C 9: 69,488,081 Y202H possibly damaging Het
Arhgef33 A G 17: 80,373,743 T771A probably benign Het
Atp12a T C 14: 56,372,589 V182A probably benign Het
Birc6 T C 17: 74,612,286 L210S probably damaging Het
Car3 A G 3: 14,864,432 T73A probably benign Het
Cd5l T C 3: 87,368,659 L312P probably damaging Het
Celf5 A G 10: 81,467,304 probably benign Het
Cep290 T A 10: 100,496,810 V257E probably damaging Het
Cntrob T C 11: 69,320,867 D177G possibly damaging Het
Copg2 A T 6: 30,810,336 F658I probably damaging Het
Csmd3 T C 15: 47,899,739 T1234A probably damaging Het
Dhx35 A G 2: 158,806,437 T72A probably damaging Het
Dmrtc2 A T 7: 24,874,367 H209L possibly damaging Het
Eml5 G T 12: 98,852,704 probably null Het
Ezh2 A G 6: 47,576,660 M41T probably damaging Het
Fmo3 A G 1: 162,968,725 S93P possibly damaging Het
Gdi2 A G 13: 3,560,018 Y213C possibly damaging Het
Gpr15 A T 16: 58,718,558 I56K probably benign Het
Gria2 G T 3: 80,691,338 S796R probably benign Het
Hectd4 T A 5: 121,291,191 probably benign Het
Hgfac T C 5: 35,042,850 probably benign Het
Hspg2 C T 4: 137,520,156 R1200W probably damaging Het
Ift52 G A 2: 163,025,355 D78N possibly damaging Het
Iqca C A 1: 90,081,416 W415L probably damaging Het
Ism1 A T 2: 139,746,043 K236N probably damaging Het
Itgb6 C T 2: 60,672,644 W43* probably null Het
Kcnk18 T A 19: 59,235,341 I306N probably damaging Het
Kctd8 T C 5: 69,340,560 K248E probably damaging Het
Layn T A 9: 51,059,533 I237F probably benign Het
Lce3f C T 3: 92,992,941 P23L unknown Het
Lct A G 1: 128,300,301 F1152L probably damaging Het
Mxra8 T C 4: 155,843,074 I413T probably damaging Het
Nedd9 A G 13: 41,317,962 V187A probably benign Het
Net1 A G 13: 3,887,642 L207P probably damaging Het
Neurod1 G T 2: 79,454,437 P201T probably benign Het
Nlrp1b A G 11: 71,161,821 F927S probably damaging Het
Ntrk3 T A 7: 78,356,041 H524L possibly damaging Het
Nup98 A C 7: 102,134,937 S1063A probably benign Het
Olfr1036 G A 2: 86,074,760 V7I possibly damaging Het
Olfr1333 T A 4: 118,829,868 M191L probably benign Het
Olfr1447 C A 19: 12,901,235 V182F probably benign Het
Olfr215 T C 6: 116,582,964 probably benign Het
Olfr657 G A 7: 104,636,159 V162I probably benign Het
Olfr747 G T 14: 50,681,166 P156Q possibly damaging Het
Pdzd2 G A 15: 12,592,460 R33W probably damaging Het
Phf21a G A 2: 92,330,515 V243I probably damaging Het
Ppp1r12b A G 1: 134,893,348 probably null Het
Rexo5 T C 7: 119,845,411 V703A probably benign Het
Rgs4 A G 1: 169,745,278 S30P probably benign Het
Rrnad1 A G 3: 87,923,817 S404P probably damaging Het
Rxra C A 2: 27,756,244 D340E probably damaging Het
Samhd1 A G 2: 157,107,547 V473A probably benign Het
Scn3a T A 2: 65,472,342 K1253N probably damaging Het
Scn7a T C 2: 66,680,955 N1207S probably benign Het
Sec24d T A 3: 123,336,517 I443N probably damaging Het
Sema4g T A 19: 44,999,242 probably null Het
Sema5b A G 16: 35,660,324 K787R probably benign Het
Serpinc1 A G 1: 160,989,647 N104D probably benign Het
Sfn T C 4: 133,601,231 H180R probably damaging Het
Slc22a6 G T 19: 8,619,107 probably null Het
Slc9a8 T C 2: 167,457,358 S217P probably benign Het
Smc6 A G 12: 11,309,269 N965D probably benign Het
Sod2 T A 17: 13,015,032 I177N probably damaging Het
Sp4 A T 12: 118,299,600 I237K probably damaging Het
Sulf2 T C 2: 166,079,612 K697R probably benign Het
Svs4 A T 2: 164,277,085 D110E unknown Het
Tas1r1 T A 4: 152,038,218 R57* probably null Het
Tlr5 T C 1: 182,973,722 I197T probably damaging Het
Tmc3 T C 7: 83,612,532 V606A probably benign Het
Tmem241 T A 18: 12,118,412 L37F probably damaging Het
Tmem59l A T 8: 70,486,253 N90K probably damaging Het
Tram1 A C 1: 13,576,456 probably benign Het
Trim15 T A 17: 36,865,169 H162L probably benign Het
Ttc28 T A 5: 111,276,811 Y1501N probably benign Het
Ttc34 T C 4: 154,862,214 V857A probably benign Het
Tulp4 A G 17: 6,139,046 T48A probably damaging Het
Usp9y T C Y: 1,368,089 E939G probably damaging Het
Utp20 A G 10: 88,770,808 I1634T probably benign Het
Vmn2r72 T C 7: 85,738,170 M729V probably benign Het
Vps13c C T 9: 67,881,447 T334M probably damaging Het
Wnk4 C G 11: 101,276,340 probably benign Het
Xpo1 A G 11: 23,271,193 N97D probably benign Het
Xpo4 A T 14: 57,603,672 F518Y probably benign Het
Zfp668 C T 7: 127,866,606 V469I possibly damaging Het
Zfp85 C A 13: 67,749,704 C83F probably damaging Het
Other mutations in Evpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Evpl APN 11 116234505 missense probably benign 0.01
IGL00896:Evpl APN 11 116222584 nonsense probably null
IGL00941:Evpl APN 11 116227901 missense probably benign 0.06
IGL01443:Evpl APN 11 116222454 missense probably damaging 1.00
IGL01523:Evpl APN 11 116233444 missense probably damaging 1.00
IGL01957:Evpl APN 11 116223222 missense probably damaging 1.00
IGL02124:Evpl APN 11 116227015 missense probably benign 0.01
IGL02334:Evpl APN 11 116231024 nonsense probably null
IGL02457:Evpl APN 11 116230113 missense possibly damaging 0.87
IGL02502:Evpl APN 11 116222718 missense probably damaging 1.00
IGL02536:Evpl APN 11 116221209 missense probably damaging 1.00
IGL02948:Evpl APN 11 116221822 missense probably damaging 1.00
IGL03183:Evpl APN 11 116221612 missense probably damaging 0.98
IGL03405:Evpl APN 11 116227927 missense possibly damaging 0.89
A4554:Evpl UTSW 11 116220834 missense probably damaging 1.00
R0082:Evpl UTSW 11 116235003 missense probably damaging 1.00
R0108:Evpl UTSW 11 116220876 missense probably damaging 1.00
R0514:Evpl UTSW 11 116223291 missense probably damaging 0.99
R0581:Evpl UTSW 11 116229490 missense probably benign 0.02
R0727:Evpl UTSW 11 116232485 missense probably damaging 1.00
R0791:Evpl UTSW 11 116227723 missense probably damaging 1.00
R0792:Evpl UTSW 11 116227723 missense probably damaging 1.00
R1079:Evpl UTSW 11 116230068 missense possibly damaging 0.48
R1514:Evpl UTSW 11 116223835 missense probably benign
R1699:Evpl UTSW 11 116227588 missense probably damaging 1.00
R1717:Evpl UTSW 11 116225492 missense probably benign 0.06
R1886:Evpl UTSW 11 116227576 missense probably damaging 0.97
R1903:Evpl UTSW 11 116227028 missense probably damaging 1.00
R2081:Evpl UTSW 11 116234266 missense probably damaging 1.00
R2137:Evpl UTSW 11 116221839 missense probably damaging 0.99
R2571:Evpl UTSW 11 116237969 missense unknown
R3081:Evpl UTSW 11 116220852 missense probably damaging 1.00
R4097:Evpl UTSW 11 116223177 missense possibly damaging 0.89
R4541:Evpl UTSW 11 116232644 missense probably benign 0.01
R4562:Evpl UTSW 11 116233399 missense possibly damaging 0.87
R4703:Evpl UTSW 11 116222505 missense probably damaging 0.98
R4947:Evpl UTSW 11 116223375 missense possibly damaging 0.88
R5243:Evpl UTSW 11 116222969 missense probably damaging 1.00
R5325:Evpl UTSW 11 116221365 missense probably damaging 1.00
R5416:Evpl UTSW 11 116234259 missense probably benign 0.13
R5580:Evpl UTSW 11 116234232 missense probably benign 0.14
R5873:Evpl UTSW 11 116234432 missense probably damaging 1.00
R6298:Evpl UTSW 11 116230922 missense probably damaging 1.00
R6438:Evpl UTSW 11 116230101 missense probably benign 0.00
R6742:Evpl UTSW 11 116222814 missense possibly damaging 0.80
R6753:Evpl UTSW 11 116237906 missense possibly damaging 0.95
R6764:Evpl UTSW 11 116222944 missense probably damaging 0.99
R6846:Evpl UTSW 11 116223807 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGACCTTGGGCTCCACTG -3'
(R):5'- CCAGAAGGTTGTCCACTTGG -3'

Sequencing Primer
(F):5'- TCCACTGAGCTGATCGCCTG -3'
(R):5'- TGTCCACTTGGAGGGCAAG -3'
Posted On2014-06-23