Incidental Mutation 'R1816:Cp'
ID204400
Institutional Source Beutler Lab
Gene Symbol Cp
Ensembl Gene ENSMUSG00000003617
Gene Nameceruloplasmin
SynonymsD3Ertd555e
MMRRC Submission 039844-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1816 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location19957054-20009145 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 19968220 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000091309] [ENSMUST00000108325] [ENSMUST00000108328] [ENSMUST00000108329]
Predicted Effect probably benign
Transcript: ENSMUST00000003714
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091309
SMART Domains Protein: ENSMUSP00000088857
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 7.7e-8 PFAM
Pfam:Cu-oxidase 220 357 1.1e-11 PFAM
Pfam:Cu-oxidase_2 280 357 2e-7 PFAM
Pfam:Cu-oxidase_3 444 557 4.6e-7 PFAM
Blast:FA58C 599 674 2e-6 BLAST
Pfam:Cu-oxidase_3 790 898 3.4e-9 PFAM
Pfam:Cu-oxidase_2 928 1055 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108325
SMART Domains Protein: ENSMUSP00000103961
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 4.9e-8 PFAM
Pfam:Cu-oxidase 220 357 9.3e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 2e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.2e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108328
SMART Domains Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108329
SMART Domains Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 89 203 8.7e-8 PFAM
Pfam:Cu-oxidase 220 357 7.8e-12 PFAM
Pfam:Cu-oxidase_2 242 356 2.1e-7 PFAM
Pfam:Cu-oxidase_3 445 555 4.4e-7 PFAM
Blast:FA58C 599 674 3e-6 BLAST
Pfam:Cu-oxidase_3 793 898 6.1e-9 PFAM
Pfam:Cu-oxidase_2 931 1055 5.2e-18 PFAM
low complexity region 1068 1079 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174803
Meta Mutation Damage Score 0.0532 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: The protein encoded by this gene is a copper-containing glycoprotein found soluble in the serum and GPI-anchored in other tissues. It oxidizes Fe(II) to Fe(III) and is proposed to play an important role in iron homeostasis. In humans mutations of this gene cause aceruloplasminemia, which is characterized by retinal degeneration, diabetes, anemia and neurological symptoms. In mouse deficiency of this gene in combination with a deficiency of its homolog hephaestin causes retinal degeneration and serves as a pathophysiological model for aceruloplasminemia and age-related macular degeneration. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit progressive accumulation of stored iron in the liver, spleen, cerebellum, and brainstem, mild iron deficiency anemia, and impaired motor coordination associated with loss of brainstem dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,994,798 Y721* probably null Het
4933405L10Rik T A 8: 105,709,859 V220E possibly damaging Het
4933434E20Rik T C 3: 90,053,091 V13A possibly damaging Het
Adam1b T G 5: 121,501,725 Q419P probably damaging Het
Ankib1 A G 5: 3,734,028 V316A probably benign Het
Anks1 T A 17: 27,986,573 D294E probably damaging Het
Atr T C 9: 95,866,694 S431P probably benign Het
BC005561 A G 5: 104,517,834 D74G probably benign Het
BC037034 A G 5: 138,260,341 V548A possibly damaging Het
Bfsp1 C T 2: 143,841,679 A242T probably benign Het
Bptf A T 11: 107,060,579 V279E probably damaging Het
Camkk2 A G 5: 122,734,180 L540P probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam12 T A 7: 18,071,765 probably null Het
Cntnap5a G T 1: 116,428,888 A823S probably benign Het
Dhx58 A G 11: 100,703,152 V163A probably damaging Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Disp1 T A 1: 183,098,575 D288V probably damaging Het
Dnah7a A G 1: 53,631,742 probably benign Het
Eaf2 T G 16: 36,808,009 probably benign Het
Efna1 T C 3: 89,276,387 N44S possibly damaging Het
Etnppl T C 3: 130,634,562 I462T probably benign Het
Fam83d G T 2: 158,768,150 A13S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Fstl1 A G 16: 37,826,724 probably null Het
Gm14226 A T 2: 155,025,629 D502V probably damaging Het
Gm5117 T A 8: 31,738,958 noncoding transcript Het
Gm973 A G 1: 59,582,399 N566S probably damaging Het
Grm7 A T 6: 111,495,791 K16* probably null Het
Hbb-bh2 G A 7: 103,840,378 T17I possibly damaging Het
Htt C T 5: 34,803,740 A237V probably benign Het
Itga6 T C 2: 71,840,809 V665A probably benign Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Mki67 T C 7: 135,707,387 D445G possibly damaging Het
Myo10 T C 15: 25,800,200 V1454A probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Odam A G 5: 87,889,470 probably null Het
Olfr1080 A T 2: 86,553,667 C152* probably null Het
Olfr1179 T G 2: 88,402,599 I112L possibly damaging Het
Olfr393 T C 11: 73,847,199 K309E probably benign Het
Olfr508 T C 7: 108,630,157 L55P probably damaging Het
Olfr695 A T 7: 106,873,488 Y252* probably null Het
Olfr998 G T 2: 85,590,925 K128N probably benign Het
Pcm1 T A 8: 41,309,537 S1412T probably damaging Het
Pgap1 A G 1: 54,492,057 L753P probably damaging Het
Pi4k2b T C 5: 52,750,746 S153P probably damaging Het
Pik3c2b C T 1: 133,101,370 A1398V probably benign Het
Pkhd1l1 T C 15: 44,528,239 I1567T possibly damaging Het
Rapgef6 G A 11: 54,694,488 V1571I probably benign Het
Rfx2 C A 17: 56,808,305 E5* probably null Het
Sh3tc1 C A 5: 35,700,584 probably null Het
Slc22a12 G A 19: 6,542,653 Q20* probably null Het
Slc4a1 A G 11: 102,351,230 C861R probably damaging Het
Snrnp25 G A 11: 32,207,565 V48I probably damaging Het
Spata1 G T 3: 146,481,207 P211Q probably damaging Het
Srgap1 G A 10: 121,925,971 Q91* probably null Het
Stab1 T C 14: 31,157,465 D686G probably benign Het
Stx8 T A 11: 68,011,326 M112K possibly damaging Het
Tfap2b A T 1: 19,209,212 K15N probably damaging Het
Thbs2 C A 17: 14,670,713 D1052Y probably benign Het
Thbs2 T A 17: 14,670,714 E1051D probably benign Het
Tlr2 T C 3: 83,838,209 Y189C probably damaging Het
Tmem268 C A 4: 63,565,710 P55T possibly damaging Het
Tnpo3 T C 6: 29,557,017 H745R probably benign Het
Ube2s T C 7: 4,811,555 N2S probably damaging Het
Ulk1 A G 5: 110,787,831 Y39H probably damaging Het
Vmn1r49 G T 6: 90,072,803 D72E possibly damaging Het
Vmn2r27 C A 6: 124,230,371 G104* probably null Het
Vmn2r92 A G 17: 18,166,677 I93V probably damaging Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zfp958 A T 8: 4,629,147 I391F possibly damaging Het
Other mutations in Cp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cp APN 3 19985662 missense possibly damaging 0.95
IGL00923:Cp APN 3 19970001 missense probably damaging 1.00
IGL01302:Cp APN 3 19966367 missense probably damaging 0.99
IGL01407:Cp APN 3 19977205 missense possibly damaging 0.79
IGL01505:Cp APN 3 19977192 missense possibly damaging 0.83
IGL01677:Cp APN 3 19966434 missense probably damaging 1.00
IGL02013:Cp APN 3 19988049 missense probably damaging 1.00
IGL02114:Cp APN 3 19966347 missense probably benign 0.16
IGL02950:Cp APN 3 19988001 missense probably damaging 0.99
IGL03330:Cp APN 3 19966435 missense probably damaging 1.00
iron10 UTSW 3 19989148 unclassified probably benign
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0320:Cp UTSW 3 19974848 splice site probably benign
R0632:Cp UTSW 3 19971082 missense probably null 0.98
R1103:Cp UTSW 3 19981985 missense possibly damaging 0.82
R1137:Cp UTSW 3 19978952 missense probably benign 0.04
R1199:Cp UTSW 3 19977152 missense probably damaging 1.00
R1523:Cp UTSW 3 19989065 missense probably benign 0.00
R1629:Cp UTSW 3 19966450 critical splice donor site probably null
R1678:Cp UTSW 3 19972717 missense probably damaging 0.99
R1733:Cp UTSW 3 19968219 splice site probably benign
R1779:Cp UTSW 3 19957385 missense possibly damaging 0.91
R1990:Cp UTSW 3 19979013 missense probably damaging 1.00
R2014:Cp UTSW 3 19987434 missense probably benign 0.00
R2179:Cp UTSW 3 19987987 missense probably damaging 1.00
R2249:Cp UTSW 3 19987570 missense probably damaging 1.00
R3440:Cp UTSW 3 19974957 missense probably benign 0.02
R3441:Cp UTSW 3 19974957 missense probably benign 0.02
R3886:Cp UTSW 3 19989111 missense probably damaging 1.00
R3937:Cp UTSW 3 19971034 missense probably damaging 1.00
R4387:Cp UTSW 3 19977202 missense probably damaging 1.00
R4412:Cp UTSW 3 19966353 missense probably damaging 1.00
R4413:Cp UTSW 3 19966353 missense probably damaging 1.00
R4514:Cp UTSW 3 19988013 missense probably damaging 0.99
R4578:Cp UTSW 3 19973888 missense probably damaging 1.00
R4579:Cp UTSW 3 19957435 splice site probably null
R4694:Cp UTSW 3 19974885 missense probably benign 0.07
R4724:Cp UTSW 3 19972647 missense probably benign 0.02
R4910:Cp UTSW 3 19989224 unclassified probably benign
R4960:Cp UTSW 3 19973797 missense probably damaging 0.96
R5043:Cp UTSW 3 19973917 missense probably benign 0.00
R5063:Cp UTSW 3 19989215 missense probably benign 0.27
R5294:Cp UTSW 3 19966316 missense probably benign 0.00
R5382:Cp UTSW 3 19978925 missense probably damaging 1.00
R5404:Cp UTSW 3 19989128 missense possibly damaging 0.92
R5569:Cp UTSW 3 19978877 missense probably damaging 1.00
R5789:Cp UTSW 3 19957290 missense probably benign
R5943:Cp UTSW 3 19964306 missense probably benign 0.11
R6492:Cp UTSW 3 19982022 missense probably benign 0.20
R6540:Cp UTSW 3 19964529 critical splice donor site probably null
R7007:Cp UTSW 3 19969973 missense probably damaging 0.97
R7126:Cp UTSW 3 19980624 missense probably damaging 1.00
R7136:Cp UTSW 3 19985658 nonsense probably null
R7212:Cp UTSW 3 19974966 missense probably damaging 1.00
R7269:Cp UTSW 3 19983477 missense probably damaging 1.00
R7316:Cp UTSW 3 19972752 missense probably damaging 1.00
R7336:Cp UTSW 3 19964532 splice site probably null
R7361:Cp UTSW 3 19964306 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GATGGTAAACACCTGTGTACTAAGA -3'
(R):5'- GCTTGGGCTGTCAAGACAT -3'

Sequencing Primer
(F):5'- CACCTGTGTACTAAGAAAATAAATAC -3'
(R):5'- GAAGAGTTCCCAGCCTGTTATAG -3'
Posted On2014-06-23