Incidental Mutation 'R1816:Nrbp1'
ID204409
Institutional Source Beutler Lab
Gene Symbol Nrbp1
Ensembl Gene ENSMUSG00000029148
Gene Namenuclear receptor binding protein 1
SynonymsB230344L17Rik, Nrbp
MMRRC Submission 039844-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1816 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31240864-31251566 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31245813 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 210 (I210N)
Ref Sequence ENSEMBL: ENSMUSP00000143872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031034] [ENSMUST00000068997] [ENSMUST00000201259] [ENSMUST00000202505] [ENSMUST00000202576] [ENSMUST00000202842]
Predicted Effect probably damaging
Transcript: ENSMUST00000031034
AA Change: I210N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031034
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 324 5.8e-26 PFAM
Pfam:Pkinase 80 327 1e-26 PFAM
low complexity region 412 436 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068997
SMART Domains Protein: ENSMUSP00000070496
Gene: ENSMUSG00000055424

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
low complexity region 78 101 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078312
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077426
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase 79 335 1e-24 PFAM
Pfam:Pkinase_Tyr 81 332 6.5e-25 PFAM
low complexity region 420 444 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000139602
AA Change: I194N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141973
AA Change: S309T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201070
Predicted Effect probably benign
Transcript: ENSMUST00000201259
Predicted Effect probably damaging
Transcript: ENSMUST00000202505
AA Change: I125N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144292
Gene: ENSMUSG00000029148
AA Change: I125N

DomainStartEndE-ValueType
STYKc 14 184 1.3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202576
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143872
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase 79 335 1e-24 PFAM
Pfam:Pkinase_Tyr 81 332 6.5e-25 PFAM
low complexity region 420 444 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202801
Predicted Effect probably benign
Transcript: ENSMUST00000202842
SMART Domains Protein: ENSMUSP00000143899
Gene: ENSMUSG00000029148

DomainStartEndE-ValueType
Pfam:Pkinase 2 88 4.8e-5 PFAM
Pfam:Pkinase_Tyr 3 88 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202982
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.9%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,994,798 Y721* probably null Het
4933405L10Rik T A 8: 105,709,859 V220E possibly damaging Het
4933434E20Rik T C 3: 90,053,091 V13A possibly damaging Het
Adam1b T G 5: 121,501,725 Q419P probably damaging Het
Ankib1 A G 5: 3,734,028 V316A probably benign Het
Anks1 T A 17: 27,986,573 D294E probably damaging Het
Atr T C 9: 95,866,694 S431P probably benign Het
BC005561 A G 5: 104,517,834 D74G probably benign Het
BC037034 A G 5: 138,260,341 V548A possibly damaging Het
Bfsp1 C T 2: 143,841,679 A242T probably benign Het
Bptf A T 11: 107,060,579 V279E probably damaging Het
Camkk2 A G 5: 122,734,180 L540P probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam12 T A 7: 18,071,765 probably null Het
Cntnap5a G T 1: 116,428,888 A823S probably benign Het
Cp T C 3: 19,968,220 probably benign Het
Dhx58 A G 11: 100,703,152 V163A probably damaging Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Disp1 T A 1: 183,098,575 D288V probably damaging Het
Dnah7a A G 1: 53,631,742 probably benign Het
Eaf2 T G 16: 36,808,009 probably benign Het
Efna1 T C 3: 89,276,387 N44S possibly damaging Het
Etnppl T C 3: 130,634,562 I462T probably benign Het
Fam83d G T 2: 158,768,150 A13S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Fstl1 A G 16: 37,826,724 probably null Het
Gm14226 A T 2: 155,025,629 D502V probably damaging Het
Gm5117 T A 8: 31,738,958 noncoding transcript Het
Gm973 A G 1: 59,582,399 N566S probably damaging Het
Grm7 A T 6: 111,495,791 K16* probably null Het
Hbb-bh2 G A 7: 103,840,378 T17I possibly damaging Het
Htt C T 5: 34,803,740 A237V probably benign Het
Itga6 T C 2: 71,840,809 V665A probably benign Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Mki67 T C 7: 135,707,387 D445G possibly damaging Het
Myo10 T C 15: 25,800,200 V1454A probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Odam A G 5: 87,889,470 probably null Het
Olfr1080 A T 2: 86,553,667 C152* probably null Het
Olfr1179 T G 2: 88,402,599 I112L possibly damaging Het
Olfr393 T C 11: 73,847,199 K309E probably benign Het
Olfr508 T C 7: 108,630,157 L55P probably damaging Het
Olfr695 A T 7: 106,873,488 Y252* probably null Het
Olfr998 G T 2: 85,590,925 K128N probably benign Het
Pcm1 T A 8: 41,309,537 S1412T probably damaging Het
Pgap1 A G 1: 54,492,057 L753P probably damaging Het
Pi4k2b T C 5: 52,750,746 S153P probably damaging Het
Pik3c2b C T 1: 133,101,370 A1398V probably benign Het
Pkhd1l1 T C 15: 44,528,239 I1567T possibly damaging Het
Rapgef6 G A 11: 54,694,488 V1571I probably benign Het
Rfx2 C A 17: 56,808,305 E5* probably null Het
Sh3tc1 C A 5: 35,700,584 probably null Het
Slc22a12 G A 19: 6,542,653 Q20* probably null Het
Slc4a1 A G 11: 102,351,230 C861R probably damaging Het
Snrnp25 G A 11: 32,207,565 V48I probably damaging Het
Spata1 G T 3: 146,481,207 P211Q probably damaging Het
Srgap1 G A 10: 121,925,971 Q91* probably null Het
Stab1 T C 14: 31,157,465 D686G probably benign Het
Stx8 T A 11: 68,011,326 M112K possibly damaging Het
Tfap2b A T 1: 19,209,212 K15N probably damaging Het
Thbs2 C A 17: 14,670,713 D1052Y probably benign Het
Thbs2 T A 17: 14,670,714 E1051D probably benign Het
Tlr2 T C 3: 83,838,209 Y189C probably damaging Het
Tmem268 C A 4: 63,565,710 P55T possibly damaging Het
Tnpo3 T C 6: 29,557,017 H745R probably benign Het
Ube2s T C 7: 4,811,555 N2S probably damaging Het
Ulk1 A G 5: 110,787,831 Y39H probably damaging Het
Vmn1r49 G T 6: 90,072,803 D72E possibly damaging Het
Vmn2r27 C A 6: 124,230,371 G104* probably null Het
Vmn2r92 A G 17: 18,166,677 I93V probably damaging Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zfp958 A T 8: 4,629,147 I391F possibly damaging Het
Other mutations in Nrbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nrbp1 APN 5 31251059 missense possibly damaging 0.74
IGL00926:Nrbp1 APN 5 31243797 missense probably benign 0.07
ghetto UTSW 5 31245846 critical splice donor site probably null
pudong UTSW 5 31250137 missense probably damaging 1.00
Shanghai UTSW 5 31245813 missense probably damaging 1.00
R0358:Nrbp1 UTSW 5 31244887 missense probably damaging 1.00
R0993:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1139:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1177:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1179:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1180:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1193:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1194:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1196:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1267:Nrbp1 UTSW 5 31250590 missense probably benign 0.00
R1302:Nrbp1 UTSW 5 31249889 missense probably benign 0.00
R1320:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1321:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1322:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1323:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1323:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1324:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1325:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1341:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1388:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1411:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1448:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1697:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1815:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1950:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1987:Nrbp1 UTSW 5 31245391 missense probably damaging 1.00
R2079:Nrbp1 UTSW 5 31251073 missense probably benign 0.08
R2142:Nrbp1 UTSW 5 31247929 missense possibly damaging 0.95
R4299:Nrbp1 UTSW 5 31250599 critical splice donor site probably null
R5115:Nrbp1 UTSW 5 31243715 nonsense probably null
R5168:Nrbp1 UTSW 5 31250137 missense probably damaging 1.00
R5640:Nrbp1 UTSW 5 31249585 missense possibly damaging 0.96
R6765:Nrbp1 UTSW 5 31245846 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATACCTGGCATAATGGAGAGTC -3'
(R):5'- TTCCAACGTTCTCTCCAACAAG -3'

Sequencing Primer
(F):5'- TGGCATAATGGAGAGTCAAAGTATAG -3'
(R):5'- CGTTCTCTCCAACAAGTACAAG -3'
Posted On2014-06-23