Incidental Mutation 'R1816:Slc4a1'
ID204441
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Namesolute carrier family 4 (anion exchanger), member 1
SynonymsAe1, CD233, l11Jus51, band 3, Empb3, erythrocyte membrane protein band 3
MMRRC Submission 039844-MU
Accession Numbers

Genbank: NM_011403; MGI: 109393

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1816 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102348824-102366203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102351230 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 861 (C861R)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
Predicted Effect probably damaging
Transcript: ENSMUST00000006749
AA Change: C861R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: C861R

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Meta Mutation Damage Score 0.582 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,994,798 Y721* probably null Het
4933405L10Rik T A 8: 105,709,859 V220E possibly damaging Het
4933434E20Rik T C 3: 90,053,091 V13A possibly damaging Het
Adam1b T G 5: 121,501,725 Q419P probably damaging Het
Ankib1 A G 5: 3,734,028 V316A probably benign Het
Anks1 T A 17: 27,986,573 D294E probably damaging Het
Atr T C 9: 95,866,694 S431P probably benign Het
BC005561 A G 5: 104,517,834 D74G probably benign Het
BC037034 A G 5: 138,260,341 V548A possibly damaging Het
Bfsp1 C T 2: 143,841,679 A242T probably benign Het
Bptf A T 11: 107,060,579 V279E probably damaging Het
Camkk2 A G 5: 122,734,180 L540P probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam12 T A 7: 18,071,765 probably null Het
Cntnap5a G T 1: 116,428,888 A823S probably benign Het
Cp T C 3: 19,968,220 probably benign Het
Dhx58 A G 11: 100,703,152 V163A probably damaging Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Disp1 T A 1: 183,098,575 D288V probably damaging Het
Dnah7a A G 1: 53,631,742 probably benign Het
Eaf2 T G 16: 36,808,009 probably benign Het
Efna1 T C 3: 89,276,387 N44S possibly damaging Het
Etnppl T C 3: 130,634,562 I462T probably benign Het
Fam83d G T 2: 158,768,150 A13S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Fstl1 A G 16: 37,826,724 probably null Het
Gm14226 A T 2: 155,025,629 D502V probably damaging Het
Gm5117 T A 8: 31,738,958 noncoding transcript Het
Gm973 A G 1: 59,582,399 N566S probably damaging Het
Grm7 A T 6: 111,495,791 K16* probably null Het
Hbb-bh2 G A 7: 103,840,378 T17I possibly damaging Het
Htt C T 5: 34,803,740 A237V probably benign Het
Itga6 T C 2: 71,840,809 V665A probably benign Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Mki67 T C 7: 135,707,387 D445G possibly damaging Het
Myo10 T C 15: 25,800,200 V1454A probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Odam A G 5: 87,889,470 probably null Het
Olfr1080 A T 2: 86,553,667 C152* probably null Het
Olfr1179 T G 2: 88,402,599 I112L possibly damaging Het
Olfr393 T C 11: 73,847,199 K309E probably benign Het
Olfr508 T C 7: 108,630,157 L55P probably damaging Het
Olfr695 A T 7: 106,873,488 Y252* probably null Het
Olfr998 G T 2: 85,590,925 K128N probably benign Het
Pcm1 T A 8: 41,309,537 S1412T probably damaging Het
Pgap1 A G 1: 54,492,057 L753P probably damaging Het
Pi4k2b T C 5: 52,750,746 S153P probably damaging Het
Pik3c2b C T 1: 133,101,370 A1398V probably benign Het
Pkhd1l1 T C 15: 44,528,239 I1567T possibly damaging Het
Rapgef6 G A 11: 54,694,488 V1571I probably benign Het
Rfx2 C A 17: 56,808,305 E5* probably null Het
Sh3tc1 C A 5: 35,700,584 probably null Het
Slc22a12 G A 19: 6,542,653 Q20* probably null Het
Snrnp25 G A 11: 32,207,565 V48I probably damaging Het
Spata1 G T 3: 146,481,207 P211Q probably damaging Het
Srgap1 G A 10: 121,925,971 Q91* probably null Het
Stab1 T C 14: 31,157,465 D686G probably benign Het
Stx8 T A 11: 68,011,326 M112K possibly damaging Het
Tfap2b A T 1: 19,209,212 K15N probably damaging Het
Thbs2 C A 17: 14,670,713 D1052Y probably benign Het
Thbs2 T A 17: 14,670,714 E1051D probably benign Het
Tlr2 T C 3: 83,838,209 Y189C probably damaging Het
Tmem268 C A 4: 63,565,710 P55T possibly damaging Het
Tnpo3 T C 6: 29,557,017 H745R probably benign Het
Ube2s T C 7: 4,811,555 N2S probably damaging Het
Ulk1 A G 5: 110,787,831 Y39H probably damaging Het
Vmn1r49 G T 6: 90,072,803 D72E possibly damaging Het
Vmn2r27 C A 6: 124,230,371 G104* probably null Het
Vmn2r92 A G 17: 18,166,677 I93V probably damaging Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zfp958 A T 8: 4,629,147 I391F possibly damaging Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102357964 missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102353903 missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102354333 missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102356267 missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102359146 critical splice acceptor site probably null
Rumor UTSW 11 102361222 nonsense probably null
A5278:Slc4a1 UTSW 11 102353815 splice site probably benign
R0011:Slc4a1 UTSW 11 102357110 missense possibly damaging 0.51
R0193:Slc4a1 UTSW 11 102352684 missense possibly damaging 0.91
R0445:Slc4a1 UTSW 11 102354366 missense probably benign 0.04
R0599:Slc4a1 UTSW 11 102357915 splice site probably benign
R0635:Slc4a1 UTSW 11 102352672 missense possibly damaging 0.78
R1496:Slc4a1 UTSW 11 102361171 missense probably benign
R1898:Slc4a1 UTSW 11 102350307 missense probably damaging 1.00
R2361:Slc4a1 UTSW 11 102356830 missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102359302 missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102357193 missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102357121 missense probably benign 0.01
R3858:Slc4a1 UTSW 11 102357121 missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102361419 utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102361419 utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102356258 missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102351503 missense probably benign 0.12
R5103:Slc4a1 UTSW 11 102353261 missense possibly damaging 0.65
R5234:Slc4a1 UTSW 11 102361383 missense probably benign 0.03
R5308:Slc4a1 UTSW 11 102359077 missense probably damaging 0.98
R5315:Slc4a1 UTSW 11 102358254 missense possibly damaging 0.77
R5478:Slc4a1 UTSW 11 102350314 missense probably damaging 0.98
R5521:Slc4a1 UTSW 11 102353266 missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102356525 missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102352531 missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102356735 missense probably damaging 0.99
R6629:Slc4a1 UTSW 11 102361222 nonsense probably null
R6717:Slc4a1 UTSW 11 102354423 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACGATTCCTATTACTGGGCC -3'
(R):5'- TCACATCCCTCAGTGGCATC -3'

Sequencing Primer
(F):5'- GATTCCTATTACTGGGCCCTTCTC -3'
(R):5'- AGTGGCATCCAGCTCTTTGAC -3'
Posted On2014-06-23