Incidental Mutation 'R1817:Pcnx'
ID204529
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
MMRRC Submission 039845-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1817 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81918642 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 528 (T528A)
Ref Sequence ENSEMBL: ENSMUSP00000152302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]
Predicted Effect probably benign
Transcript: ENSMUST00000021567
AA Change: T528A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: T528A

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221675
Predicted Effect probably benign
Transcript: ENSMUST00000221721
AA Change: T528A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222005
AA Change: T528A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1648 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (90/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,318 S600T probably benign Het
Acly T A 11: 100,495,891 Q615L probably benign Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afg3l1 G T 8: 123,501,931 K745N probably damaging Het
Armc8 T C 9: 99,536,259 T39A possibly damaging Het
Atm C A 9: 53,492,233 probably benign Het
Babam2 A G 5: 32,057,546 T324A probably damaging Het
Btd C A 14: 31,662,289 D77E possibly damaging Het
Cadm1 T A 9: 47,829,370 probably benign Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccni G T 5: 93,188,108 T144K possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cpsf7 T C 19: 10,535,439 F296L possibly damaging Het
Cyfip1 C A 7: 55,873,448 N70K possibly damaging Het
Cyp4a12b A G 4: 115,414,062 probably benign Het
Ddx20 A T 3: 105,678,580 Y816* probably null Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dgat1 T A 15: 76,502,503 M445L probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dnmt1 T C 9: 20,927,126 T215A probably benign Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Enox1 A G 14: 77,615,475 I394V possibly damaging Het
Esrp2 A T 8: 106,134,618 M183K probably damaging Het
Fam171a1 C T 2: 3,178,373 P79S probably benign Het
Fga A G 3: 83,031,775 T486A probably benign Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Fnip1 A G 11: 54,502,453 T572A probably benign Het
Fxn A C 19: 24,280,401 probably null Het
Gaa C T 11: 119,284,498 Q901* probably null Het
Gabrg1 A G 5: 70,754,251 M344T probably benign Het
Galnt7 C T 8: 57,538,178 V433M probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm5155 C T 7: 17,873,330 noncoding transcript Het
Hydin A C 8: 110,532,827 D2477A probably benign Het
Igsf6 T C 7: 121,070,808 Y37C probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kif3a T C 11: 53,598,734 Y138H probably damaging Het
Klra17 A G 6: 129,868,718 probably null Het
Lcorl A T 5: 45,795,346 I55N probably damaging Het
Lrrc49 A G 9: 60,602,776 S398P possibly damaging Het
Ltv1 A G 10: 13,179,274 L384S probably damaging Het
Mageb3 A T 2: 121,954,437 Y261* probably null Het
Mb21d1 A G 9: 78,434,311 probably null Het
Mical3 T G 6: 121,042,235 T9P probably benign Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nrap T C 19: 56,384,055 probably benign Het
Olfr164 T C 16: 19,285,877 N289D probably damaging Het
Olfr729 A G 14: 50,148,271 V201A probably benign Het
Otoa A T 7: 121,160,530 probably benign Het
Parp11 T A 6: 127,490,045 I133N probably damaging Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Pdzd7 A T 19: 45,036,176 M468K probably damaging Het
Perm1 C A 4: 156,218,604 P535Q possibly damaging Het
Pgap1 C A 1: 54,535,969 A265S probably benign Het
Pik3c2a A T 7: 116,376,512 probably null Het
Plxnd1 T C 6: 115,980,601 T491A possibly damaging Het
Pms1 A T 1: 53,206,969 D470E probably benign Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Prune2 A G 19: 17,122,081 T1650A probably benign Het
Ptprf A G 4: 118,223,265 L1264P probably benign Het
Ptprs A G 17: 56,419,527 S948P probably damaging Het
Rapgef1 T C 2: 29,686,256 V117A probably damaging Het
Rnf123 A G 9: 108,062,926 V756A probably benign Het
Sez6l2 A G 7: 126,967,119 E741G probably damaging Het
Shc3 A T 13: 51,472,852 I125K possibly damaging Het
Smr3a A T 5: 88,008,058 probably benign Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
St6gal1 A T 16: 23,321,333 K85* probably null Het
Taf1b T G 12: 24,547,122 D353E possibly damaging Het
Tcp10b C T 17: 13,067,703 P180S possibly damaging Het
Tlr9 A T 9: 106,224,943 M478L probably benign Het
Tpr A T 1: 150,419,903 E892D probably damaging Het
Trio C T 15: 27,742,495 W22* probably null Het
Usp14 A G 18: 10,024,673 V8A probably damaging Het
Vmn2r19 A T 6: 123,330,052 K506N possibly damaging Het
Vmn2r45 T A 7: 8,472,373 N552I probably damaging Het
Vmn2r56 A T 7: 12,715,615 M232K probably benign Het
Vps13b T A 15: 35,910,642 F3517L possibly damaging Het
Yif1a C T 19: 5,092,305 R247* probably null Het
Zbtb5 A G 4: 44,993,767 V539A probably benign Het
Zfp180 G A 7: 24,105,227 R357Q probably damaging Het
Zfp536 A G 7: 37,568,617 L458P probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp970 C T 2: 177,476,183 H517Y probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1758:Pcnx UTSW 12 81983484 missense probably benign 0.27
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1843:Pcnx UTSW 12 81980935 missense probably damaging 1.00
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2042:Pcnx UTSW 12 81918293 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4683:Pcnx UTSW 12 81986672 missense probably benign 0.01
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5079:Pcnx UTSW 12 81979089 nonsense probably null
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5284:Pcnx UTSW 12 81919029 missense probably benign 0.02
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5538:Pcnx UTSW 12 81860409 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6508:Pcnx UTSW 12 81912705 missense probably damaging 0.98
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6894:Pcnx UTSW 12 81987973 missense probably damaging 1.00
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGAGGGAAACACACCTGCTG -3'
(R):5'- TCATGACCAAATACAGCACTGTG -3'

Sequencing Primer
(F):5'- AACACACCTGCTGGGCCTC -3'
(R):5'- TTGGTTCCAGAGACTCCTCGAAAG -3'
Posted On2014-06-23