Incidental Mutation 'R1818:Spef2'
ID204643
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
MMRRC Submission 039846-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1818 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 9584108 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1624 (E1624K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160236]
Predicted Effect probably damaging
Transcript: ENSMUST00000159288
AA Change: E1624K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663
AA Change: E1624K

DomainStartEndE-ValueType
Pfam:CH_2 5 102 3.1e-25 PFAM
low complexity region 106 115 N/A INTRINSIC
low complexity region 137 148 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 602 789 8.8e-11 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1221 N/A INTRINSIC
low complexity region 1264 1278 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
SCOP:d1rec__ 1378 1530 3e-3 SMART
low complexity region 1605 1624 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160236
AA Change: E1614K

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: E1614K

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.5%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,858 probably null Het
Adam6b T A 12: 113,491,256 N564K probably benign Het
Ahi1 A G 10: 20,988,562 Y731C probably damaging Het
Ankk1 A G 9: 49,420,425 Y190H probably benign Het
Ankmy1 T A 1: 92,886,831 D318V probably benign Het
Ankrd33b G A 15: 31,367,121 A91V probably damaging Het
Ap3b1 A G 13: 94,471,704 N561S possibly damaging Het
Apob A G 12: 8,006,834 N1739S probably damaging Het
Apob A G 12: 8,013,064 T236A possibly damaging Het
Birc6 G A 17: 74,649,849 A3593T probably damaging Het
Bnc2 A G 4: 84,291,874 F778L possibly damaging Het
Capn2 T A 1: 182,472,597 K609N probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccl20 A G 1: 83,117,808 Y30C probably damaging Het
Cd209a G A 8: 3,745,576 T106I probably damaging Het
Cebpz A G 17: 78,935,376 L283P probably damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Clec4e T A 6: 123,285,493 D155V possibly damaging Het
Col25a1 G A 3: 130,585,737 probably null Het
Cyp2j11 A T 4: 96,297,739 V403D probably damaging Het
Cyp4v3 G A 8: 45,315,636 R296C possibly damaging Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Denr T A 5: 123,917,220 D49E probably benign Het
Dnaaf3 A T 7: 4,523,569 probably null Het
Dnaaf3 G T 7: 4,523,570 L503M probably benign Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Ehd4 C T 2: 120,102,404 W180* probably null Het
Ephb2 A G 4: 136,655,336 S984P probably benign Het
Eva1a T C 6: 82,071,144 M1T probably null Het
Fam90a1a C G 8: 21,963,771 P381A possibly damaging Het
Fam90a1a C A 8: 21,963,772 P381Q probably damaging Het
Flnc T C 6: 29,457,448 Y2382H probably damaging Het
Flrt1 A T 19: 7,095,346 L612Q probably damaging Het
Fubp1 T A 3: 152,222,169 N419K probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm11639 T A 11: 104,721,507 L652Q probably benign Het
Gm4847 T A 1: 166,638,219 H267L probably damaging Het
Golga4 T G 9: 118,572,987 V91G probably damaging Het
Hip1r T C 5: 123,995,955 probably null Het
Ice2 A G 9: 69,432,101 S967G probably benign Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Impdh2 T G 9: 108,563,212 probably null Het
Inmt C A 6: 55,173,419 V78F possibly damaging Het
Inpp5e T C 2: 26,397,874 S637G probably benign Het
Kansl1 T C 11: 104,342,457 H748R possibly damaging Het
Kif28 T C 1: 179,705,754 K541E possibly damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Kifc2 T C 15: 76,666,081 V480A probably damaging Het
Lrrc74a T C 12: 86,737,710 Y71H probably damaging Het
Ly75 T G 2: 60,311,777 T1330P probably damaging Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mgat1 T C 11: 49,261,284 I198T possibly damaging Het
Morc3 A G 16: 93,855,510 Y367C probably damaging Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Mtfr1 A G 3: 19,215,673 T162A probably damaging Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nup153 A T 13: 46,681,637 N1397K possibly damaging Het
Olfr196 T C 16: 59,167,880 K88E probably benign Het
Olfr883 T C 9: 38,026,507 S234P probably damaging Het
Olfr935 T C 9: 38,994,606 I276M possibly damaging Het
Olfr986 T C 9: 40,187,262 V49A probably benign Het
Pabpc2 G T 18: 39,774,110 V143L probably damaging Het
Panx3 T C 9: 37,664,026 K180R probably benign Het
Patj G A 4: 98,623,648 V144M possibly damaging Het
Pde1c T A 6: 56,126,892 K651* probably null Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdha2 T A 3: 141,211,199 K183* probably null Het
Pkd1l3 T A 8: 109,648,406 C1504S probably benign Het
Plbd2 A T 5: 120,487,509 probably null Het
Poteg G A 8: 27,450,167 W121* probably null Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Ptprf A G 4: 118,209,871 Y1883H probably damaging Het
Puf60 T C 15: 76,071,474 T322A possibly damaging Het
Rev3l A G 10: 39,828,424 I281M probably benign Het
Rufy1 T C 11: 50,414,572 I305V probably benign Het
Shisa9 A C 16: 12,267,562 Q329P probably damaging Het
Siglech G A 7: 55,768,584 R100Q probably damaging Het
Slc13a5 T A 11: 72,253,343 Y303F probably benign Het
Snx6 C T 12: 54,783,474 V67I possibly damaging Het
Tecpr2 A G 12: 110,926,454 Y310C probably damaging Het
Top1 T A 2: 160,715,723 L575Q probably damaging Het
Usp16 C T 16: 87,479,132 R452* probably null Het
Utrn A G 10: 12,709,964 probably null Het
Vps13b G A 15: 35,877,577 G2899E probably benign Het
Wdr78 A G 4: 103,072,657 V56A possibly damaging Het
Wipi2 T A 5: 142,658,208 L115Q probably damaging Het
Zbtb7c A C 18: 76,137,525 E228A probably damaging Het
Zfp26 T C 9: 20,442,191 T101A probably benign Het
Zfp593 A T 4: 134,245,083 probably null Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp948 G A 17: 21,584,807 V20M probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0183:Spef2 UTSW 15 9716359 missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9597401 missense possibly damaging 0.78
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9713185 missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2127:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4159:Spef2 UTSW 15 9676321 missense probably damaging 1.00
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4669:Spef2 UTSW 15 9676373 missense probably benign 0.42
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9625973 missense probably damaging 1.00
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7270:Spef2 UTSW 15 9599980 critical splice donor site probably null
R7303:Spef2 UTSW 15 9647490 missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9584207 missense probably benign 0.02
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGGTCCTGAAAAGTCTTG -3'
(R):5'- AGCATCTCCATTGCTCGAAG -3'

Sequencing Primer
(F):5'- GGTCCTGAAAAGTCTTGATGAAATTC -3'
(R):5'- GCTCGAAGCATCTCTGTCTG -3'
Posted On2014-06-23