Incidental Mutation 'R1819:Zer1'
ID204678
Institutional Source Beutler Lab
Gene Symbol Zer1
Ensembl Gene ENSMUSG00000039686
Gene Namezyg-11 related, cell cycle regulator
SynonymsC230075L19Rik, Zyg11bl
MMRRC Submission 039847-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R1819 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30097283-30124585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30110218 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 317 (A317T)
Ref Sequence ENSEMBL: ENSMUSP00000046441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]
Predicted Effect probably benign
Transcript: ENSMUST00000044751
AA Change: A317T

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686
AA Change: A317T

DomainStartEndE-ValueType
SCOP:d1jdha_ 405 774 3e-15 SMART
Blast:ARM 440 480 2e-18 BLAST
Blast:ARM 524 569 4e-24 BLAST
Blast:ARM 571 613 6e-22 BLAST
Blast:ARM 617 656 7e-8 BLAST
Blast:ARM 686 724 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113677
AA Change: A304T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686
AA Change: A304T

DomainStartEndE-ValueType
SCOP:d1jdha_ 392 761 3e-15 SMART
Blast:ARM 427 467 2e-18 BLAST
Blast:ARM 511 556 4e-24 BLAST
Blast:ARM 558 600 2e-21 BLAST
Blast:ARM 604 643 7e-8 BLAST
Blast:ARM 673 711 6e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154231
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,981,056 probably null Het
Abhd17a T C 10: 80,586,636 T71A probably benign Het
Acad11 G A 9: 104,114,539 probably null Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afdn A G 17: 13,850,848 T783A probably damaging Het
Akap13 T A 7: 75,608,705 M359K probably benign Het
Asxl3 A T 18: 22,522,376 N1148Y probably damaging Het
Atl1 T C 12: 69,963,300 S547P probably benign Het
Bace1 A T 9: 45,857,162 T252S possibly damaging Het
BC034090 A G 1: 155,225,829 S230P possibly damaging Het
Bnc2 A G 4: 84,291,874 F778L possibly damaging Het
Capn2 T A 1: 182,472,597 K609N probably benign Het
Capn8 T A 1: 182,598,826 I242N probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccdc180 A G 4: 45,926,195 E1135G possibly damaging Het
Ccdc181 C T 1: 164,282,478 Q385* probably null Het
Cdh10 G T 15: 18,991,965 G437* probably null Het
Ceacam1 T A 7: 25,463,860 Q316L possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cers4 T A 8: 4,521,232 M267K probably benign Het
Csmd3 T C 15: 47,753,735 D1930G possibly damaging Het
Cyp2j11 A T 4: 96,297,739 V403D probably damaging Het
Cyp4v3 G A 8: 45,315,636 R296C possibly damaging Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dus2 T A 8: 106,051,848 W377R probably damaging Het
E330034G19Rik A G 14: 24,298,013 D111G probably damaging Het
Erich4 C T 7: 25,615,290 R66Q possibly damaging Het
Fcgbp G T 7: 28,085,283 R256L probably benign Het
Fdxr A T 11: 115,276,104 F53Y probably damaging Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Foxo3 A T 10: 42,197,611 D84E probably benign Het
Gin1 A G 1: 97,785,226 probably null Het
Gli3 C T 13: 15,725,792 Q1255* probably null Het
Gm4847 T A 1: 166,638,219 H267L probably damaging Het
Gpr171 T C 3: 59,097,920 I145V probably benign Het
Gpr68 T A 12: 100,878,403 H294L possibly damaging Het
Gys2 T C 6: 142,461,186 E148G probably damaging Het
Heatr5b T C 17: 78,791,511 D1320G probably damaging Het
Ifnlr1 G T 4: 135,686,523 probably benign Het
Ift88 G A 14: 57,455,519 E392K probably damaging Het
Igsf9b T A 9: 27,311,593 S97T probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kcnj11 C T 7: 46,099,156 G248S probably benign Het
Kif28 T C 1: 179,705,754 K541E possibly damaging Het
Lilrb4a A G 10: 51,496,028 Y205C probably damaging Het
Lima1 T A 15: 99,819,936 H63L probably benign Het
Lonrf3 A G X: 36,358,708 I687V probably damaging Het
Lrba A G 3: 86,542,634 T2099A possibly damaging Het
Morn5 C T 2: 36,052,975 T29M probably damaging Het
Neurl1b G A 17: 26,438,700 R22H probably benign Het
Nr2e3 T C 9: 59,943,437 I380V probably damaging Het
Oas1c G A 5: 120,808,735 A10V possibly damaging Het
Olfr395 T C 11: 73,906,679 E271G probably benign Het
Olfr671 C T 7: 104,975,398 V196I probably benign Het
P3h3 T C 6: 124,854,932 T297A probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Plec C T 15: 76,179,906 R2056Q probably damaging Het
Plxna2 T A 1: 194,790,186 N1079K probably benign Het
Prr12 G C 7: 45,048,697 probably benign Het
Psip1 A G 4: 83,458,163 S480P probably benign Het
Ptpre A G 7: 135,668,993 probably benign Het
Pvalb A C 15: 78,202,584 V44G probably damaging Het
Rab3c T G 13: 110,084,135 Q164P possibly damaging Het
Rubcn T C 16: 32,826,914 K703R possibly damaging Het
Setd7 T G 3: 51,542,639 H122P probably benign Het
Slc26a8 A T 17: 28,684,834 F19I probably benign Het
Slc6a14 A G X: 21,741,047 D625G probably benign Het
Snx6 C T 12: 54,783,474 V67I possibly damaging Het
Syngr3 A G 17: 24,687,722 F40L possibly damaging Het
Syt8 G A 7: 142,438,234 G21R possibly damaging Het
Tagln A G 9: 45,930,840 F152L probably benign Het
Tcf12 G A 9: 72,109,717 T36M probably damaging Het
Tdrd6 C T 17: 43,626,551 S1202N probably benign Het
Tekt2 T C 4: 126,323,736 K179E probably damaging Het
Tekt4 G T 17: 25,473,811 probably null Het
Tmprss5 G T 9: 49,107,164 R98L probably benign Het
Tns1 G T 1: 73,916,476 probably benign Het
Tpcn1 A C 5: 120,536,227 probably null Het
Ttc6 T C 12: 57,694,500 probably null Het
Ttf1 A G 2: 29,074,784 N706S possibly damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr17 A T 8: 54,690,124 S140T probably benign Het
Wdr19 A T 5: 65,212,891 I123F possibly damaging Het
Zfp474 A G 18: 52,638,800 D175G probably damaging Het
Zfp598 T C 17: 24,681,130 probably benign Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Zer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Zer1 APN 2 30108220 critical splice donor site probably null
IGL01630:Zer1 APN 2 30101831 missense probably damaging 1.00
IGL02126:Zer1 APN 2 30104916 missense probably benign 0.10
IGL02338:Zer1 APN 2 30113393 missense probably damaging 1.00
IGL02817:Zer1 APN 2 30103394 missense probably damaging 0.99
PIT4402001:Zer1 UTSW 2 30101120 missense probably damaging 0.96
PIT4495001:Zer1 UTSW 2 30103543 missense probably benign 0.01
R0390:Zer1 UTSW 2 30108213 splice site probably benign
R0506:Zer1 UTSW 2 30101807 missense probably damaging 1.00
R0606:Zer1 UTSW 2 30104797 splice site probably benign
R0928:Zer1 UTSW 2 30101763 critical splice donor site probably null
R1167:Zer1 UTSW 2 30108246 missense probably benign 0.00
R2040:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2041:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2042:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2092:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2168:Zer1 UTSW 2 30104875 missense probably damaging 1.00
R2243:Zer1 UTSW 2 30101127 missense probably damaging 0.99
R2254:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2255:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2311:Zer1 UTSW 2 30101822 missense probably damaging 0.99
R2993:Zer1 UTSW 2 30101897 missense probably damaging 1.00
R3010:Zer1 UTSW 2 30113285 missense probably benign 0.13
R3731:Zer1 UTSW 2 30110911 missense probably benign 0.44
R4038:Zer1 UTSW 2 30107523 missense probably damaging 1.00
R5241:Zer1 UTSW 2 30104970 missense probably damaging 1.00
R5433:Zer1 UTSW 2 30100986 intron probably benign
R5443:Zer1 UTSW 2 30110996 missense probably damaging 1.00
R5524:Zer1 UTSW 2 30104854 missense probably damaging 1.00
R5936:Zer1 UTSW 2 30107667 missense probably damaging 0.97
R5999:Zer1 UTSW 2 30104997 missense probably damaging 1.00
R6598:Zer1 UTSW 2 30113274 missense probably damaging 1.00
R6965:Zer1 UTSW 2 30101047 missense possibly damaging 0.87
R7030:Zer1 UTSW 2 30111021 missense probably benign 0.00
R7190:Zer1 UTSW 2 30103432 missense probably damaging 1.00
R7218:Zer1 UTSW 2 30105012 missense probably damaging 1.00
R7252:Zer1 UTSW 2 30101892 missense probably damaging 0.99
R7383:Zer1 UTSW 2 30111241 missense probably damaging 1.00
R7417:Zer1 UTSW 2 30102822 missense probably damaging 1.00
R7459:Zer1 UTSW 2 30113325 missense probably damaging 1.00
R7463:Zer1 UTSW 2 30113437 start gained probably benign
R7477:Zer1 UTSW 2 30107976 missense probably null 0.34
X0026:Zer1 UTSW 2 30104895 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGAGGCATCTCACTGGC -3'
(R):5'- GTCCCCACCTGATCTCCAG -3'

Sequencing Primer
(F):5'- AGAGTTCTAAACTGCTGAGCC -3'
(R):5'- ACCTGATCTCCAGCCACCTG -3'
Posted On2014-06-23